National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 9226R-3 
 Symbol CG9226  Full Name CG9226 
 CG No CG9226  Old CG No CG9226 
 Synonyms CG9226 
 Accession No (Link to NCBI) NM_135153.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
[Please submit your publication]
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   ATGCTGAATCACAACGTGAGCTTCAGCAGCACCATGGTCACGTCCAATGGCGATCTTTCG 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  TTGCCCAAACTGAGCGTGACTCTTTCGGCGGAGGAGATCCTAAAGCTGCGTTCCGGGCGT 120

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 CCAAAGAACGCCGTTGAATCGCCGCATGCGGGTGTGCCCATGGAGACAAGCCTGGCTGCC 180

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 GAGGAGGAAGCGAATGGGGATGAGGAAGAGGAAAGCGTGCGGGTCGTCGACATAGAGGAC 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 ACTTTGGAGCTGACGTCGAATGGCAATGAGGCGAAGCCGGAAGACCAGGAGCTTGCGATT 300

                          ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| silico     301 GCTCCCGTCCTCCAGTACTTCCAGGGAGCACTTGTTGAG-TTGGGCCGACGCTGCTGGAC 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 CTCGTCCACGGAGGCTCAGCACTACACCAAAGGCTGCTACTGGTCCCCGGACGGCACGTG 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 CCTTCTGGTGCCCGTTCACCTAGACGGCATGCACGTTATAGAGATGCCCAGTGACCTCTA 480

9226R-3.IR_full       481 CTCCGCAGATACGGTGCAGC 500
                          |||||||||||||||||||| silico     481 CTCCGCAGATACGGTGCAGC 500

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   481  NM_135153.2  CG9226-RA (CG9226), mRNA 
0   NM_140007.1  CG5747-RA (mfr), mRNA 
0   NM_137342.2  CG30460-RC, transcript variant C (CG30460), mRNA 
0   NM_165425.2  CG2682-RB, transcript variant B (d4), mRNA 
0   NM_165424.2  CG2682-RC, transcript variant C (d4), mRNA 
0   NM_136319.3  CG2682-RA, transcript variant A (d4), mRNA 
0   NM_079066.2  CG15110-RA (botv), mRNA 
0   12  NM_141446.1  CG10055-RA (CG10055), mRNA 
0   NM_141028.1  CG12977-RA (CG12977), mRNA 
0   NM_001014715.1  CG33513-RB, transcript variant B (Nmdar2), mRNA 
0   NM_001014714.1  CG33513-RC, transcript variant C (Nmdar2), mRNA 
0   NM_001014716.1  CG33513-RA, transcript variant A (Nmdar2), mRNA 
0   NM_141341.2  CG1208-RA (CG1208), mRNA 
0   NM_001043266.1  CG34119-RA (CG34119), mRNA 
0   11  NM_130639.2  CG2918-RA (CG2918), mRNA 
0   NM_176185.1  CG8421-RE, transcript variant E (Asph), mRNA 
0   NM_166141.2  CG8421-RD, transcript variant D (Asph), mRNA 
0   NM_166140.1  CG8421-RA, transcript variant A (Asph), mRNA 
0   NM_079033.2  CG8421-RB, transcript variant B (Asph), mRNA 
0   NM_137572.2  CG10062-RA (CG10062), mRNA 
0   NM_132457.1  CG11122-RA (CG11122), mRNA 
0   NM_137581.2  CG11242-RA (CG11242), mRNA 
0   NM_165889.1  CG30043-RA (CG30043), mRNA 
0   NM_001015134.1  CG40225-PA.3 (CG40225), mRNA 
0   NR_002021.1  CR33328, miscRNA 
0   NM_001042868.1  CG34124-RA (CG34124), mRNA 
0   NM_168016.1  CG17723-RC, transcript variant C (CG17723), mRNA 
0   NM_168017.1  CG17723-RD, transcript variant D (CG17723), mRNA 
0   NM_080248.1  CG6725-RA (Sulf1), mRNA 
0   NM_143242.2  CG6420-RA (CG6420), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.