National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 9218R-2 
 Symbol sm  Full Name smooth 
 CG No CG9218  Old CG No CG9218 
 Synonyms CG9218, l(2)05338, smo, BcDNA:GH10856, sm 
 Accession No (Link to NCBI) NM_057383.5 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Cho Y, Lai CM, Lin KY, Hsu HJ.
A Targeted RNAi Screen Reveals Drosophila Female-Sterile Genes That Control the Size of Germline Stem Cell Niche During Development.
G3 (Bethesda) (2018) 8(7) 2345-2354 [ PubMed ID = 29764959 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgACAACGGCGCTAGTAATGGCA 
 Primer Seq. 3'
aatctagaggtaccATCGGGCTCATTCTTGTACAC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 ACAACGGCGC TAGTAATGGC AGTGNNGCCN GTGNNGccgg cGNAGGAGGG GCAACCATAG 
0061 TCGTCACCGA GGGGCCGCAA AACAAAAAGA TCCGCACCGG AGTCCAGCAG CCCGGGGAGA 
0121 ACGATGTGCA CATGCATGCT AGGTCCACAC CACAACAGAA CCAGCAGCAA GCACTTTATG 
0181 AACAAGTCAA ATGACGACCT ACGGAGAAAG CGTCCCGAGA CTACACGGCC AAATCACATT 
0241 CTTCTCTTCA CCATCATAAA TCCCTTCTAT CCCATCACAG TTGATGTCTT GCACAAAATC 
0301 TGTCATCCAC ATGGCCAAGT GCTGCGCATT GTCATATTCA AAAAGAATGG GGTCCAGGCC 
0361 ATGGTCGAGT TCGATAATCT GGATGCNGCC ACTAGGGCTC GCGAGAATCT AAATGGAGCC 
0421 GACATTTATG CCGGATGCTG CACTCTGAAA ATCGATTATG CCAAGCCGGA GAAATTGAAC 
0481 GTGTACAAGA ATGAGCCCGA T 
 in silico PCR Fragment
0001 ACAACGGCGC TAGTAATGGC AGTGGCGCCA GTGGCGCCGG CGGAGGAGGG GCAACCATAG 
0061 TCGTCACCGA GGGGCCGCAA AACAAAAAGA TCCGCACCGG AGTCCAGCAG CCCGGGGAGA 
0121 ACGATGTGCA CATGCATGCT AGGTCCACAC CACAACAGAA CCAGCAGCAA GCAC-TTATG 
0181 AACAAGTCAA ATGACGACCT ACGGAGAAAG CGTCCCGAGA CTACACGGCC AAATCACATT 
0241 CTTCTCTTCA CCATCATAAA TCCCTTCTAT CCCATCACAG TTGATGTCTT GCACAAAATC 
0301 TGTCATCCAC ATGGCCAAGT GCTTCGCATT GTCATATTCA AAAAGAATGG GGTCCAGGCC 
0361 ATGGTCGAGT TCGATAATCT GGATGCGGCC ACTAGGGCTC GCGAGAATCT GAATGGAGCC 
0421 GACATTTATG CCGGATGCTG CACTCTGAAA ATCGATTATG CCAAGCCGGA GAAATTGAAC 
0481 GTGTACAAGA ATGAGCCCGA T 
 Assemble Data

9218R-2.IR_full       1   ACAACGGCGCTAGTAATGGCAGTGNNGCCNGTGNNGCCGGCGNAGGAGGGGCAACCATAG 60
                          ||||||||||||||||||||||||  ||| |||  ||||||| |||||||||||||||||
9218R-2.in silico     1   ACAACGGCGCTAGTAATGGCAGTGGCGCCAGTGGCGCCGGCGGAGGAGGGGCAACCATAG 60


9218R-2.IR_full       61  TCGTCACCGAGGGGCCGCAAAACAAAAAGATCCGCACCGGAGTCCAGCAGCCCGGGGAGA 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9218R-2.in silico     61  TCGTCACCGAGGGGCCGCAAAACAAAAAGATCCGCACCGGAGTCCAGCAGCCCGGGGAGA 120


9218R-2.IR_full       121 ACGATGTGCACATGCATGCTAGGTCCACACCACAACAGAACCAGCAGCAAGCACTTTATG 180
                          |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||
9218R-2.in silico     121 ACGATGTGCACATGCATGCTAGGTCCACACCACAACAGAACCAGCAGCAAGCAC-TTATG 180


9218R-2.IR_full       181 AACAAGTCAAATGACGACCTACGGAGAAAGCGTCCCGAGACTACACGGCCAAATCACATT 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9218R-2.in silico     181 AACAAGTCAAATGACGACCTACGGAGAAAGCGTCCCGAGACTACACGGCCAAATCACATT 240


9218R-2.IR_full       241 CTTCTCTTCACCATCATAAATCCCTTCTATCCCATCACAGTTGATGTCTTGCACAAAATC 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9218R-2.in silico     241 CTTCTCTTCACCATCATAAATCCCTTCTATCCCATCACAGTTGATGTCTTGCACAAAATC 300


9218R-2.IR_full       301 TGTCATCCACATGGCCAAGTGCTGCGCATTGTCATATTCAAAAAGAATGGGGTCCAGGCC 360
                          ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||
9218R-2.in silico     301 TGTCATCCACATGGCCAAGTGCTTCGCATTGTCATATTCAAAAAGAATGGGGTCCAGGCC 360


9218R-2.IR_full       361 ATGGTCGAGTTCGATAATCTGGATGCNGCCACTAGGGCTCGCGAGAATCTAAATGGAGCC 420
                          |||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||
9218R-2.in silico     361 ATGGTCGAGTTCGATAATCTGGATGCGGCCACTAGGGCTCGCGAGAATCTGAATGGAGCC 420


9218R-2.IR_full       421 GACATTTATGCCGGATGCTGCACTCTGAAAATCGATTATGCCAAGCCGGAGAAATTGAAC 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9218R-2.in silico     421 GACATTTATGCCGGATGCTGCACTCTGAAAATCGATTATGCCAAGCCGGAGAAATTGAAC 480


9218R-2.IR_full       481 GTGTACAAGAATGAGCCCGAT 501
                          |||||||||||||||||||||
9218R-2.in silico     481 GTGTACAAGAATGAGCCCGAT 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_001032268.1  CG9218-RF, transcript variant F (sm), mRNA 
100   482  NM_057383.5  CG9218-RA, transcript variant A (sm), mRNA 
100   482  NM_001032269.1  CG9218-RE, transcript variant E (sm), mRNA 
58.29   281  NM_166368.3  CG9218-RC, transcript variant C (sm), mRNA 
0.2   11  22  NM_131924.2  CG4857-RB (CG4857), mRNA 
0   NM_135814.1  CG16850-RA (CG16850), mRNA 
0   NM_167401.1  CG1517-RB, transcript variant B (na), mRNA 
0   NM_167402.1  CG1517-RC, transcript variant C (na), mRNA 
0   29  NM_176556.1  CG33106-RA, transcript variant A (mask), mRNA 
0   27  NM_176557.1  CG33106-RB, transcript variant B (mask), mRNA 
0   NM_079090.2  CG3668-RA (fd59A), mRNA 
0   NM_169197.2  CG31187-RA (CG31187), mRNA 
0   NM_079416.2  CG4166-RA (not), mRNA 
0   NM_141524.1  CG9626-RA (CG9626), mRNA 
0   NM_169018.1  CG31530-RA (CG31530), mRNA 
0   NM_168346.1  CG32043-RB, transcript variant B (CG32043), mRNA 
0   NM_140064.2  CG32043-RA, transcript variant A (CG32043), mRNA 
0   27  NM_167231.3  CG17255-RB, transcript variant B (CG17255), mRNA 
0   27  NM_132403.3  CG17255-RA, transcript variant A (CG17255), mRNA 
0   NM_137751.3  CG10082-RB, transcript variant B (CG10082), mRNA 
0   52  NM_167335.1  CG4013-RC, transcript variant C (Smr), mRNA 
0   52  NM_167334.1  CG4013-RB, transcript variant B (Smr), mRNA 
0   52  NM_080536.2  CG4013-RA, transcript variant A (Smr), mRNA 
0   18  NM_143342.1  CG5514-RB, transcript variant B (CG5514), mRNA 
0   18  NM_170361.1  CG5514-RA, transcript variant A (CG5514), mRNA 
0   NM_142103.1  CG14846-RA (CG14846), mRNA 
0   NM_079595.2  CG6920-RA (mus309), mRNA 
0   NM_169805.3  CG7125-RD, transcript variant D (PKD), mRNA 
0   NM_169804.3  CG7125-RC, transcript variant C (PKD), mRNA 
0   NM_169803.3  CG7125-RB, transcript variant B (PKD), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.