National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 9218R-1 
 Symbol sm  Full Name smooth 
 CG No CG9218  Old CG No CG9218 
 Synonyms CG9218, l(2)05338, smo, BcDNA:GH10856, sm 
 Accession No (Link to NCBI) NM_057383.5 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
Cho Y, Lai CM, Lin KY, Hsu HJ.
A Targeted RNAi Screen Reveals Drosophila Female-Sterile Genes That Control the Size of Germline Stem Cell Niche During Development.
G3 (Bethesda) (2018) 8(7) 2345-2354 [ PubMed ID = 29764959 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          ||||||||||||||||||||||||  ||| |||  ||||||| ||||||||||||||||| silico     1   ACAACGGCGCTAGTAATGGCAGTGGCGCCAGTGGCGCCGGCGGAGGAGGGGCAACCATAG 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  TCGTCACCGAGGGGCCGCAAAACAAAAAGATCCGCACCGGAGTCCAGCAGCCCGGGGAGA 120

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| silico     121 ACGATGTGCACATGCATGCTAGGTCCACACCACAACAGAACCAGCAGCAAGCAC-TTATG 180

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 AACAAGTCAAATGACGACCTACGGAGAAAGCGTCCCGAGACTACACGGCCAAATCACATT 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 CTTCTCTTCACCATCATAAATCCCTTCTATCCCATCACAGTTGATGTCTTGCACAAAATC 300

                          ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| silico     301 TGTCATCCACATGGCCAAGTGCTTCGCATTGTCATATTCAAAAAGAATGGGGTCCAGGCC 360

                          |||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||| silico     361 ATGGTCGAGTTCGATAATCTGGATGCGGCCACTAGGGCTCGCGAGAATCTGAATGGAGCC 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 GACATTTATGCCGGATGCTGCACTCTGAAAATCGATTATGCCAAGCCGGAGAAATTGAAC 480

9218R-1.IR_full       481 GTGTACAAGAATGAGCCCGAT 501
                          ||||||||||||||||||||| silico     481 GTGTACAAGAATGAGCCCGAT 501

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_001032268.1  CG9218-RF, transcript variant F (sm), mRNA 
100   482  NM_057383.5  CG9218-RA, transcript variant A (sm), mRNA 
100   482  NM_001032269.1  CG9218-RE, transcript variant E (sm), mRNA 
58.29   281  NM_166368.3  CG9218-RC, transcript variant C (sm), mRNA 
0.2   11  22  NM_131924.2  CG4857-RB (CG4857), mRNA 
0   NM_135814.1  CG16850-RA (CG16850), mRNA 
0   NM_167401.1  CG1517-RB, transcript variant B (na), mRNA 
0   NM_167402.1  CG1517-RC, transcript variant C (na), mRNA 
0   29  NM_176556.1  CG33106-RA, transcript variant A (mask), mRNA 
0   27  NM_176557.1  CG33106-RB, transcript variant B (mask), mRNA 
0   NM_079090.2  CG3668-RA (fd59A), mRNA 
0   NM_169197.2  CG31187-RA (CG31187), mRNA 
0   NM_079416.2  CG4166-RA (not), mRNA 
0   NM_141524.1  CG9626-RA (CG9626), mRNA 
0   NM_169018.1  CG31530-RA (CG31530), mRNA 
0   NM_168346.1  CG32043-RB, transcript variant B (CG32043), mRNA 
0   NM_140064.2  CG32043-RA, transcript variant A (CG32043), mRNA 
0   27  NM_167231.3  CG17255-RB, transcript variant B (CG17255), mRNA 
0   27  NM_132403.3  CG17255-RA, transcript variant A (CG17255), mRNA 
0   NM_137751.3  CG10082-RB, transcript variant B (CG10082), mRNA 
0   52  NM_167335.1  CG4013-RC, transcript variant C (Smr), mRNA 
0   52  NM_167334.1  CG4013-RB, transcript variant B (Smr), mRNA 
0   52  NM_080536.2  CG4013-RA, transcript variant A (Smr), mRNA 
0   18  NM_143342.1  CG5514-RB, transcript variant B (CG5514), mRNA 
0   18  NM_170361.1  CG5514-RA, transcript variant A (CG5514), mRNA 
0   NM_142103.1  CG14846-RA (CG14846), mRNA 
0   NM_079595.2  CG6920-RA (mus309), mRNA 
0   NM_169805.3  CG7125-RD, transcript variant D (PKD), mRNA 
0   NM_169804.3  CG7125-RC, transcript variant C (PKD), mRNA 
0   NM_169803.3  CG7125-RB, transcript variant B (PKD), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.