National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 9159R-3 
 Symbol Kr-h2  Full Name Kruppel homolog 2 
 CG No CG9159  Old CG No CG9159 
 Synonyms Kr-h, CG9159, Kr-h2 
 Accession No (Link to NCBI) NM_078766.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS One (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgAACCGCAGCAATCTCAATCAC 
 Primer Seq. 3'
aatctagaggtaccAGGCATGATGAAGATCTCGCA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 AACCGCAGCA ATCTCAATCA CAGAACGTAC CGGCCAAGCT CCTGCAGCAT TTTCAGACAA 
0061 ATCGCATAGA TTCCGCGCTA TGGGCACTAC GTCTGCTGGT CATCTTCTTC ACCGTCAGCT 
0121 ACGTGCTGCC CATCTTTACC TCACAACAGA GCGCATTCAG CAAGGTTATT GCTGGCTAAT 
0181 GCCGCCATCT CTGCCTTGCG TTTGCACCAG AGATTGCCCG CGTTCGCGTT CAGTCGGGAG 
0241 TTCCTTGCTC GACTGTTTGC CGAGGACTCG TGTCATTACA TGATGTACTC CCTGATCTTC 
0301 TTCAACATNC CGCCCATCGC TGCTGGNTTC TGATTCCCGT GCTGCTGTAC TCAGTTCTGC 
0361 ACGCCTCAAG CTACTCGCTT AAGCTGCTGG ATCTGATTGG CCAGAACTCG TGGTGGGGTG 
0421 CCCGTTTCAT CATCTCCATT GTAGAGTTTC AGGCGGCGAA TATCCTGAAG GCAACTgNAT 
0481 TCTGCGAGAT CTTCATCATG CCT 
 in silico PCR Fragment
0001 AACCGCAGCA ATCTCAATCA CAGAACGTAC CGGCCAAGCT CCTGCAGCAT TTTCAGACAA 
0061 ATCGCATAGA TTCCGCGCTA TGGGCACTAC GTCTGCTGGT CATCTTCTTC ACCGTCAGCT 
0121 ACGTGCTGCC CATCTTTACC TCACAACAGA GCGCATTCAG CAAGGTTA-T GCTGGCTAAT 
0181 GCCGCCATCT CTGCCTTGCG TTTGCACCAG AGATTGCCCG CGTTCGCGTT CAGTCGGGAG 
0241 TTCCTTGCTC GACTGTTTGC CGAGGACTCG TGTCATTACA TGATGTACTC CCTGATCTTC 
0301 TTCAACAT-C CGCCCATCGC TGCTGG-TTC TGATTCCCGT GCTGCTGTAC TCAGTTCTGC 
0361 ACGCCTCAAG CTACTCGCTT AAGCTGCTGG ATCTGATTGG CCAGAACTCG TGGTGGGGTG 
0421 CCCGTTTCAT CATCTCCATT GTAGAGTTTC AGGCGGCGAA TATCCTGAAG GCAACTGCAT 
0481 TCTGCGAGAT CTTCATCATG CCT 
 Assemble Data

9159R-3.IR_full       1   AACCGCAGCAATCTCAATCACAGAACGTACCGGCCAAGCTCCTGCAGCATTTTCAGACAA 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9159R-3.in silico     1   AACCGCAGCAATCTCAATCACAGAACGTACCGGCCAAGCTCCTGCAGCATTTTCAGACAA 60


9159R-3.IR_full       61  ATCGCATAGATTCCGCGCTATGGGCACTACGTCTGCTGGTCATCTTCTTCACCGTCAGCT 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9159R-3.in silico     61  ATCGCATAGATTCCGCGCTATGGGCACTACGTCTGCTGGTCATCTTCTTCACCGTCAGCT 120


9159R-3.IR_full       121 ACGTGCTGCCCATCTTTACCTCACAACAGAGCGCATTCAGCAAGGTTATTGCTGGCTAAT 180
                          |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||
9159R-3.in silico     121 ACGTGCTGCCCATCTTTACCTCACAACAGAGCGCATTCAGCAAGGTTA-TGCTGGCTAAT 180


9159R-3.IR_full       181 GCCGCCATCTCTGCCTTGCGTTTGCACCAGAGATTGCCCGCGTTCGCGTTCAGTCGGGAG 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9159R-3.in silico     181 GCCGCCATCTCTGCCTTGCGTTTGCACCAGAGATTGCCCGCGTTCGCGTTCAGTCGGGAG 240


9159R-3.IR_full       241 TTCCTTGCTCGACTGTTTGCCGAGGACTCGTGTCATTACATGATGTACTCCCTGATCTTC 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9159R-3.in silico     241 TTCCTTGCTCGACTGTTTGCCGAGGACTCGTGTCATTACATGATGTACTCCCTGATCTTC 300


9159R-3.IR_full       301 TTCAACATNCCGCCCATCGCTGCTGGNTTCTGATTCCCGTGCTGCTGTACTCAGTTCTGC 360
                          |||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||
9159R-3.in silico     301 TTCAACAT-CCGCCCATCGCTGCTGG-TTCTGATTCCCGTGCTGCTGTACTCAGTTCTGC 360


9159R-3.IR_full       361 ACGCCTCAAGCTACTCGCTTAAGCTGCTGGATCTGATTGGCCAGAACTCGTGGTGGGGTG 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9159R-3.in silico     361 ACGCCTCAAGCTACTCGCTTAAGCTGCTGGATCTGATTGGCCAGAACTCGTGGTGGGGTG 420


9159R-3.IR_full       421 CCCGTTTCATCATCTCCATTGTAGAGTTTCAGGCGGCGAATATCCTGAAGGCAACTGNAT 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||
9159R-3.in silico     421 CCCGTTTCATCATCTCCATTGTAGAGTTTCAGGCGGCGAATATCCTGAAGGCAACTGCAT 480


9159R-3.IR_full       481 TCTGCGAGATCTTCATCATGCCT 503
                          |||||||||||||||||||||||
9159R-3.in silico     481 TCTGCGAGATCTTCATCATGCCT 503

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_078766.2  CG9159-RA (Kr-h2), mRNA 
0   NM_170430.2  CG31037-RA (ca), mRNA 
0   NM_169773.1  CG31360-RA (CG31360), mRNA 
0   NM_169991.1  CG6375-RB, transcript variant B (pit), mRNA 
0   NM_079722.2  CG6375-RA, transcript variant A (pit), mRNA 
0   NM_141444.1  CG10061-RA (l(3)s2214), mRNA 
0   NM_140182.1  CG7638-RA (CG7638), mRNA 
0   NM_057253.3  CG4158-RA (wor), mRNA 
0   NM_079491.2  CG5723-RB (Ten-m), mRNA 
0   NM_079713.2  CG6376-RA, transcript variant A (E2f), mRNA 
0   NM_169962.1  CG6376-RC, transcript variant C (E2f), mRNA 
0   NM_169961.1  CG6376-RB, transcript variant B (E2f), mRNA 
0   NM_140965.2  CG5274-RA, transcript variant A (CG5274), mRNA 
0   NM_168854.1  CG5274-RB, transcript variant B (CG5274), mRNA 
0   NM_078676.3  CG6223-RA (betaCop), mRNA 
0   NM_176542.1  CG7029-RA (CG7029), mRNA 
0   NM_080319.3  CG4125-RA (rst), mRNA 
0   NM_176694.1  CG3126-RB, transcript variant B (C3G), mRNA 
0   NM_132122.2  CG3126-RA, transcript variant A (C3G), mRNA 
0   NM_164716.1  CG31632-RA (CG31632), mRNA 
0   NM_169487.1  CG31342-RA (CG31342), mRNA 
0   NM_132304.2  CG9060-RA (Zpr1), mRNA 
0   NM_138984.2  CG5712-RA (ACXD), mRNA 
0   NM_135018.1  CG2976-RA (CG2976), mRNA 
0   NM_205877.1  CG32019-RD, transcript variant D (bt), mRNA 
0   NM_205876.1  CG32019-RC, transcript variant C (bt), mRNA 
0   NM_205875.1  CG32019-RE, transcript variant E (bt), mRNA 
0   NM_166790.2  CG32019-RA, transcript variant A (bt), mRNA 
0   NM_206140.1  CG8912-RC, transcript variant C (Psi), mRNA 
0   NM_057775.3  CG8912-RB, transcript variant B (Psi), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
 
DB
 
DC
 
DM
 
VM
 
VB
 
Caspase-3 signal
N
 
DB
DC
 
DM
 
VM
 
VB
 
Dcompartment   Penetrance
   

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.