National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 9154Ra-2 
 Symbol CG9154  Full Name CG9154 
 CG No CG9154  Old CG No CG9154 
 Synonyms CG9154 
 Accession No (Link to NCBI) NM_135149.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGCCGACACTTTGGCCATTTTA 
 Primer Seq. 3'
aatctagaggtaccAGGATTACCTTGCTCTCCTTC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GCCGACACTT TGGCCATTTT AAACGAATTT CTGTTGGAGA GATCAAAACG CGAAGCCGAG 
0061 GAGGAGAATC AAATCGCCAA CAAGACCGGC AAGGATGNNC AGTTCGAGGA GGATTGGCAA 
0121 TTGAGTCAGT TCTGGTACAG CACGGAAACC AAGCACGCAT TGCGTGATGT TGTGCGTAAG 
0181 CTTCTGGCGG AGCGCACGGA GGATTCGGGT GACTTTAGTA TAGCACTGCT CTCCTGCCCA 
0241 TCGCTCTACA AGGACATCAG GGAGATACAT GACACAGTGC ACATATTCGA GTTCGACAAG 
0301 CGTTTCGAGG CCTATGGCAC AGATTTTGTG CACTACGACT TGAACTGCGT AGGGAGCAAC 
0361 CCGGACTACC TCAAAGAGCA CCACCAGCAA TATGACCTCA TCGTGGCCGA CCCGCCCTTC 
0421 CTGTCCCAGG AGTGCATCGC CAAAACGTGT GAAATAATCA CTAGGCTGCA ACGAAACCAG 
0481 AAGGAGAGCA AGGTAATCCT  
 in silico PCR Fragment
0001 GCCGACACTT TGGCCATTTT AAACGAATTT CTGTTGGAGA GATCAAAACG CGAAGCCGAG 
0061 GAGGAGAATC AAATCGCCAA CAAGACCGGC AAGGATGCCC AGTTCGAGGA GGATTGGCAA 
0121 TTGAGTCAGT TCTGGTACAG CACGGAAACC AAGCACGCAT TGCGTGATGT TGTGCGTAAG 
0181 CTTCTGGCGG AGCGCACGGA GGATTCGGGT GACTTTAGTA TAGCACTGCT CTCCTGCCCA 
0241 TCGCTCTACA AGGACATCAG GGAGATACAT GACACAGTGC ACATATTCGA GTTCGACAAG 
0301 CGTTTCGAGG CCTATGGCAC AGATTTTGTG CACTACGACT TGAACTGCGT AGGGAGCAAC 
0361 CCGGACTACC TCAAAGAGCA CCACCAGCAA TATGACCTCA TCGTGGCCGA CCCGCCCTTC 
0421 CTGTCCCAGG AGTGCATCGC CAAAACGTGT GAAATAATCA CTAGGCTGCA ACGAAACCAG 
0481 AAGGAGAGCA AGGTAATCCT  
 Assemble Data

9154Ra-2.IR full       1   GCCGACACTTTGGCCATTTTAAACGAATTTCTGTTGGAGAGATCAAAACGCGAAGCCGAG 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9154Ra-2.in silico     1   GCCGACACTTTGGCCATTTTAAACGAATTTCTGTTGGAGAGATCAAAACGCGAAGCCGAG 60


9154Ra-2.IR full       61  GAGGAGAATCAAATCGCCAACAAGACCGGCAAGGATGNNCAGTTCGAGGAGGATTGGCAA 120
                           |||||||||||||||||||||||||||||||||||||  |||||||||||||||||||||
9154Ra-2.in silico     61  GAGGAGAATCAAATCGCCAACAAGACCGGCAAGGATGCCCAGTTCGAGGAGGATTGGCAA 120


9154Ra-2.IR full       121 TTGAGTCAGTTCTGGTACAGCACGGAAACCAAGCACGCATTGCGTGATGTTGTGCGTAAG 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9154Ra-2.in silico     121 TTGAGTCAGTTCTGGTACAGCACGGAAACCAAGCACGCATTGCGTGATGTTGTGCGTAAG 180


9154Ra-2.IR full       181 CTTCTGGCGGAGCGCACGGAGGATTCGGGTGACTTTAGTATAGCACTGCTCTCCTGCCCA 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9154Ra-2.in silico     181 CTTCTGGCGGAGCGCACGGAGGATTCGGGTGACTTTAGTATAGCACTGCTCTCCTGCCCA 240


9154Ra-2.IR full       241 TCGCTCTACAAGGACATCAGGGAGATACATGACACAGTGCACATATTCGAGTTCGACAAG 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9154Ra-2.in silico     241 TCGCTCTACAAGGACATCAGGGAGATACATGACACAGTGCACATATTCGAGTTCGACAAG 300


9154Ra-2.IR full       301 CGTTTCGAGGCCTATGGCACAGATTTTGTGCACTACGACTTGAACTGCGTAGGGAGCAAC 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9154Ra-2.in silico     301 CGTTTCGAGGCCTATGGCACAGATTTTGTGCACTACGACTTGAACTGCGTAGGGAGCAAC 360


9154Ra-2.IR full       361 CCGGACTACCTCAAAGAGCACCACCAGCAATATGACCTCATCGTGGCCGACCCGCCCTTC 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9154Ra-2.in silico     361 CCGGACTACCTCAAAGAGCACCACCAGCAATATGACCTCATCGTGGCCGACCCGCCCTTC 420


9154Ra-2.IR full       421 CTGTCCCAGGAGTGCATCGCCAAAACGTGTGAAATAATCACTAGGCTGCAACGAAACCAG 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9154Ra-2.in silico     421 CTGTCCCAGGAGTGCATCGCCAAAACGTGTGAAATAATCACTAGGCTGCAACGAAACCAG 480


9154Ra-2.IR full       481 AAGGAGAGCAAGGTAATCCT 500
                           ||||||||||||||||||||
9154Ra-2.in silico     481 AAGGAGAGCAAGGTAATCCT 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_135149.2  CG9154-RA (CG9154), mRNA 
0   NM_135409.1  CG9468-RA (CG9468), mRNA 
0   NM_057712.3  CG18285-RA, transcript variant A (igl), mRNA 
0   NM_057713.3  CG18285-RB, transcript variant B (igl), mRNA 
0   NM_079630.2  CG4236-RA (Caf1), mRNA 
0   NM_140067.1  CG3654-RD (CG3654), mRNA 
0   NM_079805.2  CG5954-RA, transcript variant A (l(3)mbt), mRNA 
0   NM_170330.1  CG5954-RB, transcript variant B (l(3)mbt), mRNA 
0   NM_165331.2  CG31687-RA (CG31687), mRNA 
0   NM_136191.2  CG31688-RA (CG31688), mRNA 
0   NM_165908.1  CG8824-RB, transcript variant B (fdl), mRNA 
0   NM_165909.2  CG8824-RC, transcript variant C (fdl), mRNA 
0   NM_168749.1  CG32187-RA (CG32187), mRNA 
0   NM_176301.1  CG6822-RB, transcript variant B (ergic53), mRNA 
0   NM_080037.2  CG6822-RA, transcript variant A (ergic53), mRNA 
0   NM_142255.2  CG4221-RA (CG4221), mRNA 
0   NM_001014545.1  CG33519-RB (Unc-89), mRNA 
0   NM_079035.2  CG3666-RA (Tsf3), mRNA 
0   NM_134625.2  CG17600-RA, transcript variant A (CG17600), mRNA 
0   NM_165974.2  CG4654-RB, transcript variant B (Dp), mRNA 
0   NM_057691.3  CG4654-RA, transcript variant A (Dp), mRNA 
0   NM_130550.2  CG11417-RA (CG11417), mRNA 
0   NM_132068.1  CG15899-RB (Ca-alpha1T), mRNA 
0   NM_057241.2  CG7210-RB, transcript variant B (kel), mRNA 
0   NM_165242.1  CG7210-RA, transcript variant A (kel), mRNA 
0   NM_078879.2  CG10363-RA (TepIV), mRNA 
0   NM_135153.2  CG9226-RA (CG9226), mRNA 
0   16  NM_130546.2  CG11409-RB (CG11409), mRNA 
0   NM_166356.1  CG9277-RA, transcript variant A (betaTub56D), mRNA 
0   NM_166355.2  CG9277-RD, transcript variant D (betaTub56D), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.