National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 9147R-3 
 Symbol CG9147  Full Name CG9147 
 CG No CG9147  Old CG No CG9147 
 Synonyms CG9147 
 Accession No (Link to NCBI) NM_164680.1 
 Inserted Chr. lll 
 Insertional Mutation  semi-lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS One (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTCACTTAGCCCCCGATGCTTC 
 Primer Seq. 3'
aatctagaggtaccTCTGGCTCGGTGGCCAGTTCA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TCACTTAGCC CCCGATGCTT CCAGCAAGCT ACTTCGCCCA CTGGGTCGAC ATCTGGGCTC 
0061 GTACAGCAAG GCGGTGGTTA TTGCGGCTGC CGTTAGGACA CCGAGTGCTC CCTTTCGGGC 
0121 GGAGGAGCAG CGACTGGCGG GCCTGGTGGT GGATGAACTA GTCAAAGCGC ACCAGCGTGC 
0181 GCGCGCGAGG AGTACAACAA ACTTATTGTT TCGTGCTCCT CCCTCAANGA CGcCCGCTCC 
0241 AGAGTGCAGG GAGCGGCTTT CCAGCGTGgc CCAAGAGTTG GGCCTCAAGT GTGAGCNCCC 
0301 TCGCCCTGCA GGACGACGTC TGCTCCATCA GCGGTCTGCA GATGACGCTG GACTGCCTGG 
0361 AGCGCGGCGA AGACCAGTGC ATCATTACGN GCGACACTCG CTGTCAGGTT GTTNAGNCGG 
0421 AGCACGGCGT TCTGTCCAAC GAGCTTATGA CCGTGCAGCA GCCCCAAAct cGCAAGCGAG 
0481 CTGGAACTGA ANNGGCCACC GAGCCAGA 
 in silico PCR Fragment
0001 TCACTTAGCC CCCGATGCTT CCAGC-AGCT ACTTCGCCCA CTGGGTCGAC ATCTGGGCTC 
0061 GTACAGCAAG GCGGTGGTTA TTGCGGCTGC CGTTAGGACA CCGAGTGCTC CCTTTCGGGC 
0121 GGAGGAGCAG CGACTGGCGG GCCTGGTGGT GGATGAACTA GTCAAA-CGC ACCAGCGTGC 
0181 -CGCGCGAGG AGTACAACAA ACTTATTGTT ---TGCTCCT CCCTCAA-GA CGCCCGCTCC 
0241 AGAGTGCAGG GAGCGGCTTT CCAGCGTGGC CCAAGAGTTG GGCCTCAAGT GTGAG-ACCC 
0301 TCGCCCTGCA GGACGACGTC TGCTCCATCA GCGGTCTGCA GATGACGCTG GACTGCCTGG 
0361 AGCGCGGCGA AGACCAGTGC ATCATTACGG GCGACACTCG CTGTCAGGTT GTTCAGCCGG 
0421 AGCACGGCGT TCTGTCCAAC GAGCTTATGA CCGTGCAGCA GCCCCAAACT CGCAAGCGAG 
0481 CTGGAACTGA ACTGGCCACC GAGCCAGA 
 Assemble Data

9147R-3.IR_full       1   TCACTTAGCCCCCGATGCTTCCAGCAAGCTACTTCGCCCACTGGGTCGACATCTGGGCTC 60
                          ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||
9147R-3.in silico     1   TCACTTAGCCCCCGATGCTTCCAGC-AGCTACTTCGCCCACTGGGTCGACATCTGGGCTC 60


9147R-3.IR_full       61  GTACAGCAAGGCGGTGGTTATTGCGGCTGCCGTTAGGACACCGAGTGCTCCCTTTCGGGC 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9147R-3.in silico     61  GTACAGCAAGGCGGTGGTTATTGCGGCTGCCGTTAGGACACCGAGTGCTCCCTTTCGGGC 120


9147R-3.IR_full       121 GGAGGAGCAGCGACTGGCGGGCCTGGTGGTGGATGAACTAGTCAAAGCGCACCAGCGTGC 180
                          |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||
9147R-3.in silico     121 GGAGGAGCAGCGACTGGCGGGCCTGGTGGTGGATGAACTAGTCAAA-CGCACCAGCGTGC 180


9147R-3.IR_full       181 GCGCGCGAGGAGTACAACAAACTTATTGTTTCGTGCTCCTCCCTCAANGACGCCCGCTCC 240
                           |||||||||||||||||||||||||||||   |||||||||||||| ||||||||||||
9147R-3.in silico     181 -CGCGCGAGGAGTACAACAAACTTATTGTT---TGCTCCTCCCTCAA-GACGCCCGCTCC 240


9147R-3.IR_full       241 AGAGTGCAGGGAGCGGCTTTCCAGCGTGGCCCAAGAGTTGGGCCTCAAGTGTGAGCNCCC 300
                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||  |||
9147R-3.in silico     241 AGAGTGCAGGGAGCGGCTTTCCAGCGTGGCCCAAGAGTTGGGCCTCAAGTGTGAG-ACCC 300


9147R-3.IR_full       301 TCGCCCTGCAGGACGACGTCTGCTCCATCAGCGGTCTGCAGATGACGCTGGACTGCCTGG 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9147R-3.in silico     301 TCGCCCTGCAGGACGACGTCTGCTCCATCAGCGGTCTGCAGATGACGCTGGACTGCCTGG 360


9147R-3.IR_full       361 AGCGCGGCGAAGACCAGTGCATCATTACGNGCGACACTCGCTGTCAGGTTGTTNAGNCGG 420
                          ||||||||||||||||||||||||||||| ||||||||||||||||||||||| || |||
9147R-3.in silico     361 AGCGCGGCGAAGACCAGTGCATCATTACGGGCGACACTCGCTGTCAGGTTGTTCAGCCGG 420


9147R-3.IR_full       421 AGCACGGCGTTCTGTCCAACGAGCTTATGACCGTGCAGCAGCCCCAAACTCGCAAGCGAG 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9147R-3.in silico     421 AGCACGGCGTTCTGTCCAACGAGCTTATGACCGTGCAGCAGCCCCAAACTCGCAAGCGAG 480


9147R-3.IR_full       481 CTGGAACTGAANNGGCCACCGAGCCAGA 508
                          |||||||||||  |||||||||||||||
9147R-3.in silico     481 CTGGAACTGAACTGGCCACCGAGCCAGA 508

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_135146.2  CG9147-RB, transcript variant B (CG9147), mRNA 
100   482  NM_164680.1  CG9147-RA, transcript variant A (CG9147), mRNA 
0   NM_135316.2  CG7104-RA (Spz3), mRNA 
0   17  NM_001032051.1  CG33715-RD, transcript variant D (Msp-300), mRNA 
0   13  NM_001032053.1  CG33715-RB, transcript variant B (Msp-300), mRNA 
0   NM_140580.1  CG5414-RA (CG5414), mRNA 
0   11  NM_001014500.1  CG33558-RA (CG33558), mRNA 
0   NM_175991.1  CG10595-RA, transcript variant A (d), mRNA 
0   NM_205940.1  CG10595-RB, transcript variant B (d), mRNA 
0   NM_135741.2  CG5776-RA (CG5776), mRNA 
0   NM_138187.2  CG1228-RC, transcript variant C (Ptpmeg), mRNA 
0   NM_169557.1  CG9285-RB, transcript variant B (Dip-B), mRNA 
0   NM_169558.1  CG9285-RC, transcript variant C (Dip-B), mRNA 
0   NM_142061.2  CG9285-RA, transcript variant A (Dip-B), mRNA 
0   NM_167830.1  CG1228-RA, transcript variant A (Ptpmeg), mRNA 
0   NM_167831.1  CG1228-RD, transcript variant D (Ptpmeg), mRNA 
0   NM_142396.1  CG7397-RA (CG7397), mRNA 
0   NM_167222.1  CG32688-RB, transcript variant B (Hk), mRNA 
0   NM_078549.3  CG32688-RA, transcript variant A (Hk), mRNA 
0   NM_001038734.1  CG16902-RC (Hr4), mRNA 
0   NM_143720.2  CG6773-RA (sec13), mRNA 
0   NM_134812.2  CG7074-RA (mio), mRNA 
0   NM_078589.2  CG1903-RB, transcript variant B (sno), mRNA 
0   NM_167491.1  CG3525-RC, transcript variant C (eas), mRNA 
0   NM_167489.1  CG3525-RD, transcript variant D (eas), mRNA 
0   NM_167490.1  CG3525-RB, transcript variant B (eas), mRNA 
0   NM_167353.1  CG1903-RA, transcript variant A (sno), mRNA 
0   NM_176741.1  CG3525-RE, transcript variant E (eas), mRNA 
0   NM_078640.2  CG3525-RA, transcript variant A (eas), mRNA 
0   NM_167559.1  CG32564-RA (CG32564), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.