National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 9147R-1 
 Symbol CG9147  Full Name CG9147 
 CG No CG9147  Old CG No CG9147 
 Synonyms CG9147 
 Accession No (Link to NCBI) NM_164680.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
[Please submit your publication]
Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS One (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| silico     1   TCACTTAGCCCCCGATGCTTCCAGC-AGCTACTTCGCCCACTGGGTCGACATCTGGGCTC 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  GTACAGCAAGGCGGTGGTTATTGCGGCTGCCGTTAGGACACCGAGTGCTCCCTTTCGGGC 120

                          |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| silico     121 GGAGGAGCAGCGACTGGCGGGCCTGGTGGTGGATGAACTAGTCAAA-CGCACCAGCGTGC 180

                           |||||||||||||||||||||||||||||   |||||||||||||| |||||||||||| silico     181 -CGCGCGAGGAGTACAACAAACTTATTGTT---TGCTCCTCCCTCAA-GACGCCCGCTCC 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||  ||| silico     241 AGAGTGCAGGGAGCGGCTTTCCAGCGTGGCCCAAGAGTTGGGCCTCAAGTGTGAG-ACCC 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 TCGCCCTGCAGGACGACGTCTGCTCCATCAGCGGTCTGCAGATGACGCTGGACTGCCTGG 360

                          ||||||||||||||||||||||||||||| ||||||||||||||||||||||| || ||| silico     361 AGCGCGGCGAAGACCAGTGCATCATTACGGGCGACACTCGCTGTCAGGTTGTTCAGCCGG 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 AGCACGGCGTTCTGTCCAACGAGCTTATGACCGTGCAGCAGCCCCAAACTCGCAAGCGAG 480

                          |||||||||||  ||||||||||||||| silico     481 CTGGAACTGAACTGGCCACCGAGCCAGA 508

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_135146.2  CG9147-RB, transcript variant B (CG9147), mRNA 
100   482  NM_164680.1  CG9147-RA, transcript variant A (CG9147), mRNA 
0   NM_135316.2  CG7104-RA (Spz3), mRNA 
0   17  NM_001032051.1  CG33715-RD, transcript variant D (Msp-300), mRNA 
0   13  NM_001032053.1  CG33715-RB, transcript variant B (Msp-300), mRNA 
0   NM_140580.1  CG5414-RA (CG5414), mRNA 
0   11  NM_001014500.1  CG33558-RA (CG33558), mRNA 
0   NM_175991.1  CG10595-RA, transcript variant A (d), mRNA 
0   NM_205940.1  CG10595-RB, transcript variant B (d), mRNA 
0   NM_135741.2  CG5776-RA (CG5776), mRNA 
0   NM_138187.2  CG1228-RC, transcript variant C (Ptpmeg), mRNA 
0   NM_169557.1  CG9285-RB, transcript variant B (Dip-B), mRNA 
0   NM_169558.1  CG9285-RC, transcript variant C (Dip-B), mRNA 
0   NM_142061.2  CG9285-RA, transcript variant A (Dip-B), mRNA 
0   NM_167830.1  CG1228-RA, transcript variant A (Ptpmeg), mRNA 
0   NM_167831.1  CG1228-RD, transcript variant D (Ptpmeg), mRNA 
0   NM_142396.1  CG7397-RA (CG7397), mRNA 
0   NM_167222.1  CG32688-RB, transcript variant B (Hk), mRNA 
0   NM_078549.3  CG32688-RA, transcript variant A (Hk), mRNA 
0   NM_001038734.1  CG16902-RC (Hr4), mRNA 
0   NM_143720.2  CG6773-RA (sec13), mRNA 
0   NM_134812.2  CG7074-RA (mio), mRNA 
0   NM_078589.2  CG1903-RB, transcript variant B (sno), mRNA 
0   NM_167491.1  CG3525-RC, transcript variant C (eas), mRNA 
0   NM_167489.1  CG3525-RD, transcript variant D (eas), mRNA 
0   NM_167490.1  CG3525-RB, transcript variant B (eas), mRNA 
0   NM_167353.1  CG1903-RA, transcript variant A (sno), mRNA 
0   NM_176741.1  CG3525-RE, transcript variant E (eas), mRNA 
0   NM_078640.2  CG3525-RA, transcript variant A (eas), mRNA 
0   NM_167559.1  CG32564-RA (CG32564), mRNA 
 Wing Disc
JNK signal
Caspase-3 signal
Dcompartment   Penetrance

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.