National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 9144R-2 
 Symbol CG9144  Full Name CG9144 
 CG No CG9144  Old CG No CG9144 
 Synonyms CG9144 
 Accession No (Link to NCBI) NM_135145.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Du J, Zhang J, Su Y, Liu M, Ospina JK, Yang S, Zhu AJ.
In vivo RNAi screen reveals neddylation genes as novel regulators of Hedgehog signaling.
PLoS One (2011) 6(9) e24168 [ PubMed ID = 21931660 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgAAGTGACCTTCAAGAAGGCCC 
 Primer Seq. 3'
aatctagaggtaccGTGCGCATACTTCTCCGAACA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 AAGTGACCTT CAAGAAGGCC CGACTGGGAA AGGAGAGACT GGTGGAACAA TCGGAGGAGG 
0061 AGGAACGCGA TGAGGGCTCC TCTGGCCAAG ATTTGTTTGG GTGGTGGGCC CTGcCGGAGC 
0121 CAGCGCTCTT GATGATCTTT GAGCGCCTGA GTGTGCCCGA TCTGCTGAGG GCGAGTCGCT 
0181 GCTGTGTGCG GTGGCACAGC ATCGCCAAGG ACGACTTATT GTGGCGCCAC AAGTTCCAGG 
0241 AGCACTTCAA AGCCTCTCCG AGCATTCCGC TCAAGCCGGG GTCCGAAAGC TGGCGAGCGG 
0301 AGTACAAGCG CCTGTCCATG CACATACCCT TTGTCCAGGC ACAGCGACTG GAGCCCACTG 
0361 TGGAGAACAA CCACGGCCAC ACGCACCAAG TGCTGCATGT AAGCTTTGCC CACAACGGGG 
0421 AAATGTTTGC CACCTGCTCC AAGGACGGAT ATGTGATAAT CTGGAACGCC CAGCATCCGT 
0481 GTTCGGAGAA GTATGCGCAC  
 in silico PCR Fragment
0001 AAGTGACCTT CAAGAAGGCC CGACTGGGAA AGGAGAGACT GGTGGAACAA TCGGAGGAGG 
0061 AGGAACGCGA TGAGGGCTCC TCTGGCCAAG ATTTGTTTGG GTGGTGGGCC CTGCCGGAGC 
0121 CAGCGCTCTT GATGATCTTT GAGCGCCTGA GTGTGCCCGA TCTGCTGAGG GCGAGTCGCT 
0181 GCTGTGTGCG GTGGCACAGC ATCGCCAAGG ACGACTTATT GTGGCGCCAC AAGTTCCAGG 
0241 AGCACTTCAA AGCCTCTCCG AGCATTCCGC TCAAGCCGGG GTCCGAAAGC TGGCGAGCGG 
0301 AGTACAAGCG CCTGTCCATG CACATACCCT TTGTCCAGGC ACAGCGACTG GAGCCCACTG 
0361 TGGAGAACAA CCACGGCCAC ACGCACCAAG TGCTGCATGT AAGCTTTGCC CACAACGGGG 
0421 AAATGTTTGC CACCTGCTCC AAGGACGGAT ATGTGATAAT CTGGAACGCC CAGCATCCGT 
0481 GTTCGGAGAA GTATGCGCAC  
 Assemble Data

9144R-2.IR_full       1   AAGTGACCTTCAAGAAGGCCCGACTGGGAAAGGAGAGACTGGTGGAACAATCGGAGGAGG 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9144R-2.in silico     1   AAGTGACCTTCAAGAAGGCCCGACTGGGAAAGGAGAGACTGGTGGAACAATCGGAGGAGG 60


9144R-2.IR_full       61  AGGAACGCGATGAGGGCTCCTCTGGCCAAGATTTGTTTGGGTGGTGGGCCCTGCCGGAGC 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9144R-2.in silico     61  AGGAACGCGATGAGGGCTCCTCTGGCCAAGATTTGTTTGGGTGGTGGGCCCTGCCGGAGC 120


9144R-2.IR_full       121 CAGCGCTCTTGATGATCTTTGAGCGCCTGAGTGTGCCCGATCTGCTGAGGGCGAGTCGCT 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9144R-2.in silico     121 CAGCGCTCTTGATGATCTTTGAGCGCCTGAGTGTGCCCGATCTGCTGAGGGCGAGTCGCT 180


9144R-2.IR_full       181 GCTGTGTGCGGTGGCACAGCATCGCCAAGGACGACTTATTGTGGCGCCACAAGTTCCAGG 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9144R-2.in silico     181 GCTGTGTGCGGTGGCACAGCATCGCCAAGGACGACTTATTGTGGCGCCACAAGTTCCAGG 240


9144R-2.IR_full       241 AGCACTTCAAAGCCTCTCCGAGCATTCCGCTCAAGCCGGGGTCCGAAAGCTGGCGAGCGG 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9144R-2.in silico     241 AGCACTTCAAAGCCTCTCCGAGCATTCCGCTCAAGCCGGGGTCCGAAAGCTGGCGAGCGG 300


9144R-2.IR_full       301 AGTACAAGCGCCTGTCCATGCACATACCCTTTGTCCAGGCACAGCGACTGGAGCCCACTG 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9144R-2.in silico     301 AGTACAAGCGCCTGTCCATGCACATACCCTTTGTCCAGGCACAGCGACTGGAGCCCACTG 360


9144R-2.IR_full       361 TGGAGAACAACCACGGCCACACGCACCAAGTGCTGCATGTAAGCTTTGCCCACAACGGGG 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9144R-2.in silico     361 TGGAGAACAACCACGGCCACACGCACCAAGTGCTGCATGTAAGCTTTGCCCACAACGGGG 420


9144R-2.IR_full       421 AAATGTTTGCCACCTGCTCCAAGGACGGATATGTGATAATCTGGAACGCCCAGCATCCGT 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9144R-2.in silico     421 AAATGTTTGCCACCTGCTCCAAGGACGGATATGTGATAATCTGGAACGCCCAGCATCCGT 480


9144R-2.IR_full       481 GTTCGGAGAAGTATGCGCAC 500
                          ||||||||||||||||||||
9144R-2.in silico     481 GTTCGGAGAAGTATGCGCAC 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_135145.1  CG9144-RA (CG9144), mRNA 
0.2   NM_139749.2  CG10479-RA (CG10479), mRNA 
0.2   NM_140863.1  CG9283-RA (CG9283), mRNA 
0   NM_132702.2  CG11063-RB (CG11063), mRNA 
0   NM_134701.2  CG3883-RA (CG3883), mRNA 
0   NM_137562.1  CG18607-RA (CG18607), mRNA 
0   NM_079641.2  CG4938-RA (Aats-ser), mRNA 
0   NM_141451.2  CG14608-RA (CG14608), mRNA 
0   19  NM_175960.3  CG33196-RB (dp), mRNA 
0   NM_143508.1  CG7928-RA (CG7928), mRNA 
0   NM_166689.1  CG3629-RB, transcript variant B (Dll), mRNA 
0   NM_079133.1  CG3629-RA, transcript variant A (Dll), mRNA 
0   NM_142661.2  CG17273-RA (CG17273), mRNA 
0   NM_176460.1  CG31374-RC, transcript variant C (CG31374), mRNA 
0   NM_169390.2  CG31374-RB, transcript variant B (CG31374), mRNA 
0   NM_057614.2  CG4926-RA (Ror), mRNA 
0   NM_001043156.1  CG8779-RB, transcript variant B (nrm), mRNA 
0   NM_206760.1  CG9214-RB, transcript variant B (Tob), mRNA 
0   NM_132876.3  CG9214-RA, transcript variant A (Tob), mRNA 
0   NM_079494.3  CG8779-RA, transcript variant A (nrm), mRNA 
0   NM_141829.2  CG14709-RA (CG14709), mRNA 
0   NM_143705.2  CG12225-RA (Spt6), mRNA 
0   10  NM_132274.2  CG1785-RA (CG1785), mRNA 
0   NM_165581.1  CG11198-RB, transcript variant B (CG11198), mRNA 
0   NM_136498.1  CG11198-RA, transcript variant A (CG11198), mRNA 
0   NM_165993.1  CG6016-RB, transcript variant B (CG6016), mRNA 
0   NM_137033.2  CG6016-RA, transcript variant A (CG6016), mRNA 
0   NM_132867.1  CG9170-RA, transcript variant A (CG9170), mRNA 
0   NM_206753.1  CG9170-RB, transcript variant B (CG9170), mRNA 
0   NM_137887.2  CG3501-RA (CG3501), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.