National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 9135R-2 
 Symbol CG9135  Full Name CG9135 
 CG No CG9135  Old CG No CG9135 
 Synonyms CG9135 
 Accession No (Link to NCBI) NM_135141.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTTCCGGCCCTCGAACAGCTGA 
 Primer Seq. 3'
aatctagaggtaccGAGACGCCCGAAACCGCCAAA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 NTCCGGCCCT CGAACAGCTG AACATAGTGC AAGCTGCTGT CGGCCGGCAC CACACTCTGT 
0061 TTCTCACTGA CACGGGAACC GTATACGCCT GCGGCGAAAA CAAGTCCGGC CAGTGCGGTG 
0121 TGGGAAATAC GCATGCTAAC ATTTATTCGC CCACGCCAAT TAACTACCGA GGTCCGCCGA 
0181 TCATTCGCAT CGGTTGCGGA GCTGNAGTTC TCTGTTATTC TGGACATTAA AGGTAGCCTG 
0241 CACACATTTG GGCTGCCGGA GTACGGTCAG TTGGGACACA ATACTGACGC CAAGTACTTT 
0301 GTCAACGCCA ACAAATTGTC ATTCCATTTC GAGACGTCGC CCAAAAAGGT CGTTTTGTAC 
0361 ATAGAGAAGA GCAAGGAGGG TCATGTAACG CCAGTCGATG GCGTGCAGAT AGTTGACTTT 
0421 GCTTGCGGCA ATAATCACAC GGTCGCCATC GACTCCAAGA AGCGCGTTTA TAGCTGGGGC 
0481 TTTGGCGGTT TCGGGCGTCT C 
 in silico PCR Fragment
0001 TTCCGGCCCT CGAACAGCTG AACATAGTGC AAGCTGCTGT CGGCCGGCAC CACACTCTGT 
0061 TTCTCACTGA CACGGGAACC GTATACGCCT GCGGCGAAAA CAAGTCCGGC CAGTGCGGTG 
0121 TGGGAAATAC GCATGCTAAC ATTTATTCGC CCACGCCAAT TAACTACCGA GGTCCGCCGA 
0181 TCATTCGCAT CGGTTGCGGA GCTG-AGTTC TCTGTTATTC TGGACATTAA AGGTAGCCTG 
0241 CACACATTTG GGCTGCCGGA GTACGGTCAG TTGGGACACA ATACTGACGC CAAGTACTTT 
0301 GTCAACGCCA ACAAATTGTC ATTCCATTTC GAGACGTCGC CCAAAAAGGT CGTTTTGTAC 
0361 ATAGAGAAGA GCAAGGAGGG TCATGTAACG CCAGTCGATG GCGTGCAGAT AGTTGACTTT 
0421 GCTTGCGGCA ATAATCACAC GGTCGCCATC GACTCCAAGA AGCGCGTTTA TAGCTGGGGC 
0481 TTTGGCGGTT TCGGGCGTCT C 
 Assemble Data

9135R-2.IR_full        1   TCCGGCCCTCGAACAGCTGAACATAGTGCAAGCTGCTGTCGGCCGGCACCACACTCTGT 59
                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9135R-2.in silico      1   TCCGGCCCTCGAACAGCTGAACATAGTGCAAGCTGCTGTCGGCCGGCACCACACTCTGT 59


9135R-2.IR_full       61  TTCTCACTGACACGGGAACCGTATACGCCTGCGGCGAAAACAAGTCCGGCCAGTGCGGTG 119
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9135R-2.in silico     61  TTCTCACTGACACGGGAACCGTATACGCCTGCGGCGAAAACAAGTCCGGCCAGTGCGGTG 119


9135R-2.IR_full       121 TGGGAAATACGCATGCTAACATTTATTCGCCCACGCCAATTAACTACCGAGGTCCGCCGA 179
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9135R-2.in silico     121 TGGGAAATACGCATGCTAACATTTATTCGCCCACGCCAATTAACTACCGAGGTCCGCCGA 179


9135R-2.IR_full       181 TCATTCGCATCGGTTGCGGAGCTGNAGTTCTCTGTTATTCTGGACATTAAAGGTAGCCTG 239
                          |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||
9135R-2.in silico     181 TCATTCGCATCGGTTGCGGAGCTG-AGTTCTCTGTTATTCTGGACATTAAAGGTAGCCTG 239


9135R-2.IR_full       241 CACACATTTGGGCTGCCGGAGTACGGTCAGTTGGGACACAATACTGACGCCAAGTACTTT 299
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9135R-2.in silico     241 CACACATTTGGGCTGCCGGAGTACGGTCAGTTGGGACACAATACTGACGCCAAGTACTTT 299


9135R-2.IR_full       301 GTCAACGCCAACAAATTGTCATTCCATTTCGAGACGTCGCCCAAAAAGGTCGTTTTGTAC 359
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9135R-2.in silico     301 GTCAACGCCAACAAATTGTCATTCCATTTCGAGACGTCGCCCAAAAAGGTCGTTTTGTAC 359


9135R-2.IR_full       361 ATAGAGAAGAGCAAGGAGGGTCATGTAACGCCAGTCGATGGCGTGCAGATAGTTGACTTT 419
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9135R-2.in silico     361 ATAGAGAAGAGCAAGGAGGGTCATGTAACGCCAGTCGATGGCGTGCAGATAGTTGACTTT 419


9135R-2.IR_full       421 GCTTGCGGCAATAATCACACGGTCGCCATCGACTCCAAGAAGCGCGTTTATAGCTGGGGC 479
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9135R-2.in silico     421 GCTTGCGGCAATAATCACACGGTCGCCATCGACTCCAAGAAGCGCGTTTATAGCTGGGGC 479


9135R-2.IR_full       481 TTTGGCGGTTTCGGGCGTCTC 500
                          |||||||||||||||||||||
9135R-2.in silico     481 TTTGGCGGTTTCGGGCGTCTC 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_164679.1  CG9135-RB, transcript variant B (CG9135), mRNA 
100   482  NM_135141.2  CG9135-RA, transcript variant A (CG9135), mRNA 
0   NM_142384.1  CG14325-RA (CG14325), mRNA 
0   NM_136844.3  CG9005-RA (CG9005), mRNA 
0   NM_140202.1  CG6168-RB (CG6168), mRNA 
0   NM_135570.3  CG6144-RA, transcript variant A (CG6144), mRNA 
0   NM_001038806.1  CG6144-RB, transcript variant B (CG6144), mRNA 
0   NM_169378.1  CG4863-RB, transcript variant B (RpL3), mRNA 
0   NM_169379.1  CG4863-RE, transcript variant E (RpL3), mRNA 
0   NM_079592.2  CG4863-RA, transcript variant A (RpL3), mRNA 
0   NM_079015.2  CG8404-RA (Sox15), mRNA 
0   NM_165881.1  CG8487-RA, transcript variant A (garz), mRNA 
0   NM_136917.2  CG8487-RB, transcript variant B (garz), mRNA 
0   NM_079798.2  CG5507-RA (T48), mRNA 
0   NM_001038984.1  CG12877-RC, transcript variant C (CG12877), mRNA 
0   NM_143327.2  CG12877-RA, transcript variant A (CG12877), mRNA 
0   NM_170355.2  CG12877-RB, transcript variant B (CG12877), mRNA 
0   NM_078533.1  CG11213-RA (Cp38), mRNA 
0   NM_136597.3  CG8170-RA, transcript variant A (CG8170), mRNA 
0   NM_001043068.1  CG8170-RB, transcript variant B (CG8170), mRNA 
0   NM_001014486.1  CG4952-RG, transcript variant G (dac), mRNA 
0   NM_165162.1  CG4952-RB, transcript variant B (dac), mRNA 
0   NM_165161.1  CG4952-RD, transcript variant D (dac), mRNA 
0   NM_165159.1  CG4952-RC, transcript variant C (dac), mRNA 
0   NM_165160.1  CG4952-RA, transcript variant A (dac), mRNA 
0   NM_001014487.1  CG4952-RF, transcript variant F (dac), mRNA 
0   NM_165163.1  CG4952-RE, transcript variant E (dac), mRNA 
0   NM_001031867.1  CG33950-RF, transcript variant F (trol), mRNA 
0   NM_001031863.1  CG33950-RD, transcript variant D (trol), mRNA 
0   NM_132819.2  CG8105-RA (CG8105), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.