National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 9131R-3 
 Symbol slmo  Full Name slowmo 
 CG No CG9131  Old CG No CG9131 
 Synonyms CT26166, kisir, CG9131, slmo, Kisir, slowmo 
 Accession No (Link to NCBI) NM_164677.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   TGGACATCGGAGCACATATTCAACCACCCGTGGGAGACGGTCACGCAGGCGGCGTGGCGC 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  AAGTACCCCAATCCGATGACGCCCTCCATCATTGGCACGGACGTGGTCGAGCGCCGTGTG 120

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | silico     121 GTGGACGGCGTCCTGCACACGCATCGCCTGGTGCAGTCCAAGTGGTACTTCCCCAAGT-G 180

                          ||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||| silico     181 GACGCACGCGCTG-ATCGGCACGGCCAAAACTTGTTTCGCCAGCGAACGCTCCACGGTGG 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 ACCCGGAGCGCAAACAGATGGTGCTGAAGACAAACAACCTCACCTTCTGCCGCAACATCA 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 GCGTGGACGAGGTGCTCTACTATGAGCCGCATCCGTCGGATGCCAGCAAGACGCTGCTCA 360

                          |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 AGCAGGAGGC-CACCGTGACCGTCTTTGGTGTGCCGCTGTCCCACTACATGGAGGACCTG 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 CTCACCTCGACCATTAGCACAAATGCCGGCAAGGGACGCCAGGGCCTGGAGTGGGTGATC 480

9131R-3.IR_full       481 GGGCTGATCAACACGGAGGTCAA 503
                          ||||||||||||||||||||||| silico     481 GGGCTGATCAACACGGAGGTCAA 503

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_164677.1  CG9131-RA, transcript variant A (slmo), mRNA 
100   482  NM_079966.2  CG9131-RB, transcript variant B (slmo), mRNA 
0   NM_133088.1  CG6632-RA (Ing3), mRNA 
0   NM_134943.1  CG3213-RA (CG3213), mRNA 
0   NM_133004.1  CG8211-RA (CG8211), mRNA 
0   NM_001014556.1  CG11513-RB, transcript variant B (armi), mRNA 
0   NM_139559.2  CG11513-RA, transcript variant A (armi), mRNA 
0   NM_169804.3  CG7125-RC, transcript variant C (PKD), mRNA 
0   NM_169805.3  CG7125-RD, transcript variant D (PKD), mRNA 
0   NM_140962.1  CG13248-RA (CG13248), mRNA 
0   NM_001031917.1  CG1414-RB, transcript variant B (bbx), mRNA 
0   NM_001031918.1  CG1410-RA, transcript variant A (waw), mRNA 
0   NM_133089.2  CG6659-RA, transcript variant A (CG6659), mRNA 
0   NM_001031977.1  CG32464-RN, transcript variant N (l(3)82Fd), mRNA 
0   NM_169038.1  CG32464-RJ, transcript variant J (l(3)82Fd), mRNA 
0   NM_001043213.1  CG32464-RP, transcript variant P (l(3)82Fd), mRNA 
0   NM_143760.2  CG32464-RB, transcript variant B (l(3)82Fd), mRNA 
0   NM_169039.2  CG32464-RL, transcript variant L (l(3)82Fd), mRNA 
0   NM_206429.1  CG32464-RG, transcript variant G (l(3)82Fd), mRNA 
0   NM_170640.2  CG32464-RK, transcript variant K (l(3)82Fd), mRNA 
0   NM_001043214.1  CG32464-RO, transcript variant O (l(3)82Fd), mRNA 
0   NM_001031978.1  CG32464-RM, transcript variant M (l(3)82Fd), mRNA 
0   NM_170641.1  CG32464-RF, transcript variant F (l(3)82Fd), mRNA 
0   NM_169047.1  CG32464-RD, transcript variant D (l(3)82Fd), mRNA 
0   NM_142194.1  CG5038-RA (CG5038), mRNA 
0   NM_142874.2  CG6747-RA (Ir), mRNA 
0   NM_142861.2  CG6697-RA (CG6697), mRNA 
0   NM_001015260.1  CG2893-PB.3 (CG2893), mRNA 
0   NM_001015261.1  CG2893-PC.3 (CG2893), mRNA 
0   NM_001015262.1  CG2893-PA.3 (CG2893), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.