National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 9131R-1 
 Symbol slmo  Full Name slowmo 
 CG No CG9131  Old CG No CG9131 
 Synonyms CT26166, kisir, CG9131, slmo, Kisir, slowmo 
 Accession No (Link to NCBI) NM_164677.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Ohhara Y, Nakamura A, Kato Y, Yamakawa-Kobayashi K.
Chaperonin TRiC/CCT supports mitotic exit and entry into endocycle in Drosophila.
PLoS Genet (2019) 15(4) e1008121 [ PubMed ID = 31034473 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTGGACATCGGAGCACATATTC 
 Primer Seq. 3'
aatctagaggtaccTTGACCTCCGTGTTGATCAGC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TGGACATCGG AGCACATATT CAACCACCCG TGGGAGACGG TCACGCAGGC GGCGTGGCGC 
0061 AAGTACCCCA ATCCGATGAC GCCCTCCATC ATTGGCACGG ACGTGGTCGA GCGCCGTGTG 
0121 GTGGACGGCG TCCTGCACAC GCATCGCCTG GTGCAGTCCA AGTGGTACTT CCCCAAGTGG 
0181 GACGCACGCG CTGNATCGGC ACGGCTAAAA CTTGTTTCGC CAGCGAACgC TCCACGGTGG 
0241 ACCCGGAGCG CAAACAGATG GTGCTGAAGA CAAACAACCT CACCTTCTGC CGCAACATCA 
0301 GCGTGGACGA GGTGCTCTAC TATGAGCCGC ATCCGTCGGA TGCCAGCAAG ACGCTGCTCA 
0361 AGCAGGAGGC NCACCGTGAC CGTCTTTGGT GTGCCGCTGT CCCACTACAT GGAGGACCTG 
0421 CTCACCTCGA CCATTAGCAC AAATGCCGGC AAGGGACGCC AGGGCCTGGA GTGGGTGATC 
0481 GGGCTGATCA ACACGGAGGT CAA 
 in silico PCR Fragment
0001 TGGACATCGG AGCACATATT CAACCACCCG TGGGAGACGG TCACGCAGGC GGCGTGGCGC 
0061 AAGTACCCCA ATCCGATGAC GCCCTCCATC ATTGGCACGG ACGTGGTCGA GCGCCGTGTG 
0121 GTGGACGGCG TCCTGCACAC GCATCGCCTG GTGCAGTCCA AGTGGTACTT CCCCAAGT-G 
0181 GACGCACGCG CTG-ATCGGC ACGGCCAAAA CTTGTTTCGC CAGCGAACGC TCCACGGTGG 
0241 ACCCGGAGCG CAAACAGATG GTGCTGAAGA CAAACAACCT CACCTTCTGC CGCAACATCA 
0301 GCGTGGACGA GGTGCTCTAC TATGAGCCGC ATCCGTCGGA TGCCAGCAAG ACGCTGCTCA 
0361 AGCAGGAGGC -CACCGTGAC CGTCTTTGGT GTGCCGCTGT CCCACTACAT GGAGGACCTG 
0421 CTCACCTCGA CCATTAGCAC AAATGCCGGC AAGGGACGCC AGGGCCTGGA GTGGGTGATC 
0481 GGGCTGATCA ACACGGAGGT CAA 
 Assemble Data

9131R-1.IR_full       1   TGGACATCGGAGCACATATTCAACCACCCGTGGGAGACGGTCACGCAGGCGGCGTGGCGC 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9131R-1.in silico     1   TGGACATCGGAGCACATATTCAACCACCCGTGGGAGACGGTCACGCAGGCGGCGTGGCGC 60


9131R-1.IR_full       61  AAGTACCCCAATCCGATGACGCCCTCCATCATTGGCACGGACGTGGTCGAGCGCCGTGTG 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9131R-1.in silico     61  AAGTACCCCAATCCGATGACGCCCTCCATCATTGGCACGGACGTGGTCGAGCGCCGTGTG 120


9131R-1.IR_full       121 GTGGACGGCGTCCTGCACACGCATCGCCTGGTGCAGTCCAAGTGGTACTTCCCCAAGTGG 180
                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
9131R-1.in silico     121 GTGGACGGCGTCCTGCACACGCATCGCCTGGTGCAGTCCAAGTGGTACTTCCCCAAGT-G 180


9131R-1.IR_full       181 GACGCACGCGCTGNATCGGCACGGCTAAAACTTGTTTCGCCAGCGAACGCTCCACGGTGG 240
                          ||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||
9131R-1.in silico     181 GACGCACGCGCTG-ATCGGCACGGCCAAAACTTGTTTCGCCAGCGAACGCTCCACGGTGG 240


9131R-1.IR_full       241 ACCCGGAGCGCAAACAGATGGTGCTGAAGACAAACAACCTCACCTTCTGCCGCAACATCA 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9131R-1.in silico     241 ACCCGGAGCGCAAACAGATGGTGCTGAAGACAAACAACCTCACCTTCTGCCGCAACATCA 300


9131R-1.IR_full       301 GCGTGGACGAGGTGCTCTACTATGAGCCGCATCCGTCGGATGCCAGCAAGACGCTGCTCA 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9131R-1.in silico     301 GCGTGGACGAGGTGCTCTACTATGAGCCGCATCCGTCGGATGCCAGCAAGACGCTGCTCA 360


9131R-1.IR_full       361 AGCAGGAGGCNCACCGTGACCGTCTTTGGTGTGCCGCTGTCCCACTACATGGAGGACCTG 420
                          |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
9131R-1.in silico     361 AGCAGGAGGC-CACCGTGACCGTCTTTGGTGTGCCGCTGTCCCACTACATGGAGGACCTG 420


9131R-1.IR_full       421 CTCACCTCGACCATTAGCACAAATGCCGGCAAGGGACGCCAGGGCCTGGAGTGGGTGATC 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9131R-1.in silico     421 CTCACCTCGACCATTAGCACAAATGCCGGCAAGGGACGCCAGGGCCTGGAGTGGGTGATC 480


9131R-1.IR_full       481 GGGCTGATCAACACGGAGGTCAA 503
                          |||||||||||||||||||||||
9131R-1.in silico     481 GGGCTGATCAACACGGAGGTCAA 503

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_164677.1  CG9131-RA, transcript variant A (slmo), mRNA 
100   482  NM_079966.2  CG9131-RB, transcript variant B (slmo), mRNA 
0   NM_133088.1  CG6632-RA (Ing3), mRNA 
0   NM_134943.1  CG3213-RA (CG3213), mRNA 
0   NM_133004.1  CG8211-RA (CG8211), mRNA 
0   NM_001014556.1  CG11513-RB, transcript variant B (armi), mRNA 
0   NM_139559.2  CG11513-RA, transcript variant A (armi), mRNA 
0   NM_169804.3  CG7125-RC, transcript variant C (PKD), mRNA 
0   NM_169805.3  CG7125-RD, transcript variant D (PKD), mRNA 
0   NM_140962.1  CG13248-RA (CG13248), mRNA 
0   NM_001031917.1  CG1414-RB, transcript variant B (bbx), mRNA 
0   NM_001031918.1  CG1410-RA, transcript variant A (waw), mRNA 
0   NM_133089.2  CG6659-RA, transcript variant A (CG6659), mRNA 
0   NM_001031977.1  CG32464-RN, transcript variant N (l(3)82Fd), mRNA 
0   NM_169038.1  CG32464-RJ, transcript variant J (l(3)82Fd), mRNA 
0   NM_001043213.1  CG32464-RP, transcript variant P (l(3)82Fd), mRNA 
0   NM_143760.2  CG32464-RB, transcript variant B (l(3)82Fd), mRNA 
0   NM_169039.2  CG32464-RL, transcript variant L (l(3)82Fd), mRNA 
0   NM_206429.1  CG32464-RG, transcript variant G (l(3)82Fd), mRNA 
0   NM_170640.2  CG32464-RK, transcript variant K (l(3)82Fd), mRNA 
0   NM_001043214.1  CG32464-RO, transcript variant O (l(3)82Fd), mRNA 
0   NM_001031978.1  CG32464-RM, transcript variant M (l(3)82Fd), mRNA 
0   NM_170641.1  CG32464-RF, transcript variant F (l(3)82Fd), mRNA 
0   NM_169047.1  CG32464-RD, transcript variant D (l(3)82Fd), mRNA 
0   NM_142194.1  CG5038-RA (CG5038), mRNA 
0   NM_142874.2  CG6747-RA (Ir), mRNA 
0   NM_142861.2  CG6697-RA (CG6697), mRNA 
0   NM_001015260.1  CG2893-PB.3 (CG2893), mRNA 
0   NM_001015261.1  CG2893-PC.3 (CG2893), mRNA 
0   NM_001015262.1  CG2893-PA.3 (CG2893), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.