National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 9127R-2 
 Symbol ade2  Full Name adenosine 2 
 CG No CG9127  Old CG No CG9127 
 Synonyms 153122_at, pym, CG9127, ade2 
 Accession No (Link to NCBI) NM_057864.3 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Cho Y, Lai CM, Lin KY, Hsu HJ.
A Targeted RNAi Screen Reveals Drosophila Female-Sterile Genes That Control the Size of Germline Stem Cell Niche During Development.
G3 (Bethesda) (2018) 8(7) 2345-2354 [ PubMed ID = 29764959 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATGGAGCGCTGCTATCATCTG 
 Primer Seq. 3'
aatctagaggtaccTAGTCGTTGAAGGCTAAGCCC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 ATGGAGCGCT GCTATCATCT GGAGTACAGC GCTCAGGCAG AGCACTCACT GGCCCTGGAC 
0061 GAGCTGCTGG TGTGGCTGGT CAAGCAACCG CTGAGCAAAG GCCAGAGCTT GTCCAGGCAA 
0121 CCTGCCCTGC AGTCAACTGG GTCGAGTCAG TTGCTCCTGG AGATCGGGCC GCGTTTTAAC 
0181 TTCTCCACGC CGTACTCCAC GAACTGCGTG AACATATTCC AGAATCTCGG GTACTCAGAG 
0241 GTGCGTCGCA TGGAAACCTC CACCCGCTAT CTGGTTACTT TTGGCGAGGG ATCAAAGGCG 
0301 CCGGAGGCAG CCAGGTTTGT TCCTCTGCTC GGTGACCGCA TGACCCAGTG CTTGTACACC 
0361 GAGGAGAATA CCCCCAAGGC GAGCTTTGAC GAGCAGCTAC CTGAGCGCCA GGCCAACTGG 
0421 CATTTCGTGC CCGTTTTGGA GGAGGGTAGG GCGGCACTGG AGCGGATTAA TCAGGAGCTG 
0481 GGCTTAGCCT TCAACGACTA  
 in silico PCR Fragment
0001 ATGGAGCGCT GCTATCATCT GGAGTACAGC GCTCAGGCAG AGCACTCACT GGCCCTGGAC 
0061 GAGCTGCTGG TGTGGCTGGT CAAGCAACCG CTGAGCAAAG GCCAGAGCTT GTCCAGGCAA 
0121 CCTGCCCTGC AGTCAACTGG GTCGAGTCAG TTGCTCCTGG AGATCGGGCC GCGTTTTAAC 
0181 TTCTCCACGC CGTACTCCAC GAACTGCGTG AACATATTCC AGAATCTCGG GTACTCAGAG 
0241 GTGCGTCGCA TGGAAACCTC CACCCGCTAT CTGGTTACTT TTGGCGAGGG ATCAAAGGCG 
0301 CCGGAGGCAG CCAGGTTTGT TCCTCTGCTC GGTGACCGCA TGACCCAGTG CTTGTACACC 
0361 GAGGAGAATA CCCCCAAGGC GAGCTTTGAC GAGCAGCTAC CTGAGCGCCA GGCCAACTGG 
0421 CATTTCGTGC CCGTTTTGGA GGAGGGTAGG GCGGCACTGG AGCGGATTAA TCAGGAGCTG 
0481 GGCTTAGCCT TCAACGACTA  
 Assemble Data

9127R-2.IR_full       1   ATGGAGCGCTGCTATCATCTGGAGTACAGCGCTCAGGCAGAGCACTCACTGGCCCTGGAC 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9127R-2.in silico     1   ATGGAGCGCTGCTATCATCTGGAGTACAGCGCTCAGGCAGAGCACTCACTGGCCCTGGAC 60


9127R-2.IR_full       61  GAGCTGCTGGTGTGGCTGGTCAAGCAACCGCTGAGCAAAGGCCAGAGCTTGTCCAGGCAA 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9127R-2.in silico     61  GAGCTGCTGGTGTGGCTGGTCAAGCAACCGCTGAGCAAAGGCCAGAGCTTGTCCAGGCAA 120


9127R-2.IR_full       121 CCTGCCCTGCAGTCAACTGGGTCGAGTCAGTTGCTCCTGGAGATCGGGCCGCGTTTTAAC 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9127R-2.in silico     121 CCTGCCCTGCAGTCAACTGGGTCGAGTCAGTTGCTCCTGGAGATCGGGCCGCGTTTTAAC 180


9127R-2.IR_full       181 TTCTCCACGCCGTACTCCACGAACTGCGTGAACATATTCCAGAATCTCGGGTACTCAGAG 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9127R-2.in silico     181 TTCTCCACGCCGTACTCCACGAACTGCGTGAACATATTCCAGAATCTCGGGTACTCAGAG 240


9127R-2.IR_full       241 GTGCGTCGCATGGAAACCTCCACCCGCTATCTGGTTACTTTTGGCGAGGGATCAAAGGCG 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9127R-2.in silico     241 GTGCGTCGCATGGAAACCTCCACCCGCTATCTGGTTACTTTTGGCGAGGGATCAAAGGCG 300


9127R-2.IR_full       301 CCGGAGGCAGCCAGGTTTGTTCCTCTGCTCGGTGACCGCATGACCCAGTGCTTGTACACC 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9127R-2.in silico     301 CCGGAGGCAGCCAGGTTTGTTCCTCTGCTCGGTGACCGCATGACCCAGTGCTTGTACACC 360


9127R-2.IR_full       361 GAGGAGAATACCCCCAAGGCGAGCTTTGACGAGCAGCTACCTGAGCGCCAGGCCAACTGG 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9127R-2.in silico     361 GAGGAGAATACCCCCAAGGCGAGCTTTGACGAGCAGCTACCTGAGCGCCAGGCCAACTGG 420


9127R-2.IR_full       421 CATTTCGTGCCCGTTTTGGAGGAGGGTAGGGCGGCACTGGAGCGGATTAATCAGGAGCTG 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9127R-2.in silico     421 CATTTCGTGCCCGTTTTGGAGGAGGGTAGGGCGGCACTGGAGCGGATTAATCAGGAGCTG 480


9127R-2.IR_full       481 GGCTTAGCCTTCAACGACTA 500
                          ||||||||||||||||||||
9127R-2.in silico     481 GGCTTAGCCTTCAACGACTA 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_057864.3  CG9127-RA, transcript variant A (ade2), mRNA 
100   482  NM_164675.1  CG9127-RB, transcript variant B (ade2), mRNA 
100   482  NM_164676.1  CG9127-RC, transcript variant C (ade2), mRNA 
0   NM_168646.1  CG32156-RC, transcript variant C (Mbs), mRNA 
0   NM_134726.2  CG4715-RA (Iris), mRNA 
0   NM_137567.1  CG9811-RA (Rgk1), mRNA 
0   NM_142007.2  CG8483-RA (CG8483), mRNA 
0   NM_168681.2  CG3849-RB, transcript variant B (Lasp), mRNA 
0   NM_130637.2  CG3071-RA (CG3071), mRNA 
0   NM_140655.1  CG3849-RA, transcript variant A (Lasp), mRNA 
0   NM_132289.1  CG10970-RA (CG10970), mRNA 
0   21  NM_136257.2  CG8677-RA (CG8677), mRNA 
0   18  NM_165363.1  CG31626-RB, transcript variant B (CG31626), mRNA 
0   18  NM_165362.1  CG31626-RA, transcript variant A (CG31626), mRNA 
0   NM_137397.1  CG30106-RA (CG30106), mRNA 
0   NM_079860.2  CG12073-RA (5-HT7), mRNA 
0   NM_136690.2  CG1513-RA (CG1513), mRNA 
0   NM_136034.1  CG10174-RA (Ntf-2r), mRNA 
0   NM_167091.1  CG4532-RA, transcript variant A (pod1), mRNA 
0   NM_167092.1  CG4532-RB, transcript variant B (pod1), mRNA 
0   NM_167093.1  CG4532-RC, transcript variant C (pod1), mRNA 
0   NM_132124.4  CG4532-RD, transcript variant D (pod1), mRNA 
0   NM_078597.2  CG15871-RA (mRpL38), mRNA 
0   NM_167094.1  CG4532-RE, transcript variant E (pod1), mRNA 
0   NM_140402.2  CG17689-RA, transcript variant A (CG17689), mRNA 
0   NM_167085.1  CG3168-RB, transcript variant B (CG3168), mRNA 
0   NM_169758.1  CG5407-RA, transcript variant A (Sur-8), mRNA 
0   NM_132117.1  CG3168-RA, transcript variant A (CG3168), mRNA 
0   NM_167086.1  CG3168-RC, transcript variant C (CG3168), mRNA 
0   NM_135642.2  CG6181-RA, transcript variant A (CG6181), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.