National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 9127R-1 
 Symbol ade2  Full Name adenosine 2 
 CG No CG9127  Old CG No CG9127 
 Synonyms 153122_at, pym, CG9127, ade2 
 Accession No (Link to NCBI) NM_057864.3 
 Inserted Chr. ll 
 Insertional Mutation  3 lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
[Please submit your publication]
Cho Y, Lai CM, Lin KY, Hsu HJ.
A Targeted RNAi Screen Reveals Drosophila Female-Sterile Genes That Control the Size of Germline Stem Cell Niche During Development.
G3 (Bethesda) (2018) 8(7) 2345-2354 [ PubMed ID = 29764959 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   ATGGAGCGCTGCTATCATCTGGAGTACAGCGCTCAGGCAGAGCACTCACTGGCCCTGGAC 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  GAGCTGCTGGTGTGGCTGGTCAAGCAACCGCTGAGCAAAGGCCAGAGCTTGTCCAGGCAA 120

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 CCTGCCCTGCAGTCAACTGGGTCGAGTCAGTTGCTCCTGGAGATCGGGCCGCGTTTTAAC 180

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 TTCTCCACGCCGTACTCCACGAACTGCGTGAACATATTCCAGAATCTCGGGTACTCAGAG 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 GTGCGTCGCATGGAAACCTCCACCCGCTATCTGGTTACTTTTGGCGAGGGATCAAAGGCG 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 CCGGAGGCAGCCAGGTTTGTTCCTCTGCTCGGTGACCGCATGACCCAGTGCTTGTACACC 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 GAGGAGAATACCCCCAAGGCGAGCTTTGACGAGCAGCTACCTGAGCGCCAGGCCAACTGG 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 CATTTCGTGCCCGTTTTGGAGGAGGGTAGGGCGGCACTGGAGCGGATTAATCAGGAGCTG 480

9127R-1.IR_full       481 GGCTTAGCCTTCAACGACTA 500
                          |||||||||||||||||||| silico     481 GGCTTAGCCTTCAACGACTA 500

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_057864.3  CG9127-RA, transcript variant A (ade2), mRNA 
100   482  NM_164675.1  CG9127-RB, transcript variant B (ade2), mRNA 
100   482  NM_164676.1  CG9127-RC, transcript variant C (ade2), mRNA 
0   NM_168646.1  CG32156-RC, transcript variant C (Mbs), mRNA 
0   NM_134726.2  CG4715-RA (Iris), mRNA 
0   NM_137567.1  CG9811-RA (Rgk1), mRNA 
0   NM_142007.2  CG8483-RA (CG8483), mRNA 
0   NM_168681.2  CG3849-RB, transcript variant B (Lasp), mRNA 
0   NM_130637.2  CG3071-RA (CG3071), mRNA 
0   NM_140655.1  CG3849-RA, transcript variant A (Lasp), mRNA 
0   NM_132289.1  CG10970-RA (CG10970), mRNA 
0   21  NM_136257.2  CG8677-RA (CG8677), mRNA 
0   18  NM_165363.1  CG31626-RB, transcript variant B (CG31626), mRNA 
0   18  NM_165362.1  CG31626-RA, transcript variant A (CG31626), mRNA 
0   NM_137397.1  CG30106-RA (CG30106), mRNA 
0   NM_079860.2  CG12073-RA (5-HT7), mRNA 
0   NM_136690.2  CG1513-RA (CG1513), mRNA 
0   NM_136034.1  CG10174-RA (Ntf-2r), mRNA 
0   NM_167091.1  CG4532-RA, transcript variant A (pod1), mRNA 
0   NM_167092.1  CG4532-RB, transcript variant B (pod1), mRNA 
0   NM_167093.1  CG4532-RC, transcript variant C (pod1), mRNA 
0   NM_132124.4  CG4532-RD, transcript variant D (pod1), mRNA 
0   NM_078597.2  CG15871-RA (mRpL38), mRNA 
0   NM_167094.1  CG4532-RE, transcript variant E (pod1), mRNA 
0   NM_140402.2  CG17689-RA, transcript variant A (CG17689), mRNA 
0   NM_167085.1  CG3168-RB, transcript variant B (CG3168), mRNA 
0   NM_169758.1  CG5407-RA, transcript variant A (Sur-8), mRNA 
0   NM_132117.1  CG3168-RA, transcript variant A (CG3168), mRNA 
0   NM_167086.1  CG3168-RC, transcript variant C (CG3168), mRNA 
0   NM_135642.2  CG6181-RA, transcript variant A (CG6181), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.