National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 9117R-1 
 Symbol CG9117  Full Name CG9117 
 CG No CG9117  Old CG No CG9117 
 Synonyms CG9117 
 Accession No (Link to NCBI) NM_135139.2 
 Inserted Chr. ll 
 Insertional Mutation  lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Dourlen P, Fernandez-Gomez FJ, Dupont C, Grenier-Boley B, Bellenguez C, Obriot H, Caillierez R, Sottejeau Y, Chapuis J, Bretteville A, Abdelfettah F, Delay C, Malmanche N, Soininen H, Hiltunen M, Galas MC, Amouyel P, Sergeant N, Buée L, Lambert JC, Dermaut B.
Functional screening of Alzheimer risk loci identifies PTK2B as an in vivo modulator and early marker of Tau pathology.
Mol Psychiatry (2017) 22(6) 874-883 [ PubMed ID = 27113998 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS One (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgACGAAACCAGGTGACCGTGCT 
 Primer Seq. 3'
aatctagaggtaccTCTCATCGTCGATGTCCTCGC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 ACGAAACCAG GTGACCGTGC TCCAGGTCGG CTATTCTCGC CAAGAAGAAG GAGACGANGT 
0061 CCGCCATGCG GGCTAACTGC ACATGCACAC TGGTCCGCTG CCGGGATGGC ACCAACATAA 
0121 TCGTGGACAC ACTGACGGCC TGGGATGGAG ATCACCTGCG TTCGTTGTTG GGCCAGCAGG 
0181 GACTAGGCGT CGATGACATC CACGTGGTGG TCTGCTCTCA CGGACACTCT GACCACATCG 
0241 GTTGCAACTA TCTGTTTCAG AAGGCACGGA TGCATTTGGT CGGCGCATGT GCCTCACATC 
0301 ACGACCTCTA CATGGACCAC CTTGGTAGTG GTAATCCAGA CGAGCAACTG GCCCTAGATT 
0361 CGAATGCCGA GGTGGTAGTG AGGCGGTCGC CAGGACACAC CCTCAGCTGC GTTTCAGTTC 
0421 TTGTGGAAAA TTCCCAGCTG GGTGGACGGG TCGGTATCAC CGGAGATNTC TTCGAGCGTC 
0481 GCGAGGACAT CGACGATGAG A 
 in silico PCR Fragment
0001 ACGAAACCAG GTGACCGTGC TCCAGGTCGG CTATTCTCGC CAAGAAGAAG GAGACGA-GT 
0061 CCGCCATGCG GGCTAACTGC ACATGCACAC TGGTCCGCTG CCGGGATGGC ACCAACATAA 
0121 TCGTGGACAC ACTGACGGCC TGGGATGGAG ATCACCTGCG TTCGTTGTTG GGCCAGCAGG 
0181 GACTAGGCGT CGATGACATC CACGTGGTGG TCTGCTCTCA CGGACACTCT GACCACATCG 
0241 GTTGCAACTA TCTGTTTCAG AAGGCACGAA TGCATTTGGT CGGCGCATGT GCCTCACATC 
0301 ACGACCTCTA CATGGACCAC CTTGGTAGTG GTAATCCAGA CGAGCAACTG GCCCTAGATT 
0361 CGAATGCCGA GGTGGTAGTG AGGCGGTCGC CAGGACACAC CCTCAGCTGC GTTTCAGTTC 
0421 TTGTGGAAAA TTCCCAGCTG GGTGGACGGG TCGGTATCAC CGGAGATCTC TTCGAGCGTC 
0481 GCGAGGACAT CGACGATGAG A 
 Assemble Data

9117R-1.IR_full       1   ACGAAACCAGGTGACCGTGCTCCAGGTCGGCTATTCTCGCCAAGAAGAAGGAGACGANGT 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||
9117R-1.in silico     1   ACGAAACCAGGTGACCGTGCTCCAGGTCGGCTATTCTCGCCAAGAAGAAGGAGACGA-GT 60


9117R-1.IR_full       61  CCGCCATGCGGGCTAACTGCACATGCACACTGGTCCGCTGCCGGGATGGCACCAACATAA 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9117R-1.in silico     61  CCGCCATGCGGGCTAACTGCACATGCACACTGGTCCGCTGCCGGGATGGCACCAACATAA 120


9117R-1.IR_full       121 TCGTGGACACACTGACGGCCTGGGATGGAGATCACCTGCGTTCGTTGTTGGGCCAGCAGG 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9117R-1.in silico     121 TCGTGGACACACTGACGGCCTGGGATGGAGATCACCTGCGTTCGTTGTTGGGCCAGCAGG 180


9117R-1.IR_full       181 GACTAGGCGTCGATGACATCCACGTGGTGGTCTGCTCTCACGGACACTCTGACCACATCG 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9117R-1.in silico     181 GACTAGGCGTCGATGACATCCACGTGGTGGTCTGCTCTCACGGACACTCTGACCACATCG 240


9117R-1.IR_full       241 GTTGCAACTATCTGTTTCAGAAGGCACGGATGCATTTGGTCGGCGCATGTGCCTCACATC 300
                          |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||
9117R-1.in silico     241 GTTGCAACTATCTGTTTCAGAAGGCACGAATGCATTTGGTCGGCGCATGTGCCTCACATC 300


9117R-1.IR_full       301 ACGACCTCTACATGGACCACCTTGGTAGTGGTAATCCAGACGAGCAACTGGCCCTAGATT 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9117R-1.in silico     301 ACGACCTCTACATGGACCACCTTGGTAGTGGTAATCCAGACGAGCAACTGGCCCTAGATT 360


9117R-1.IR_full       361 CGAATGCCGAGGTGGTAGTGAGGCGGTCGCCAGGACACACCCTCAGCTGCGTTTCAGTTC 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9117R-1.in silico     361 CGAATGCCGAGGTGGTAGTGAGGCGGTCGCCAGGACACACCCTCAGCTGCGTTTCAGTTC 420


9117R-1.IR_full       421 TTGTGGAAAATTCCCAGCTGGGTGGACGGGTCGGTATCACCGGAGATNTCTTCGAGCGTC 480
                          ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||
9117R-1.in silico     421 TTGTGGAAAATTCCCAGCTGGGTGGACGGGTCGGTATCACCGGAGATCTCTTCGAGCGTC 480


9117R-1.IR_full       481 GCGAGGACATCGACGATGAGA 501
                          |||||||||||||||||||||
9117R-1.in silico     481 GCGAGGACATCGACGATGAGA 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_135139.2  CG9117-RA (CG9117), mRNA 
0   NM_132081.2  CG15896-RA (CG15896), mRNA 
0   NM_142942.3  CG31140-RA, transcript variant A (CG31140), mRNA 
0   NM_166108.1  CG8205-RF, transcript variant F (fus), mRNA 
0   NM_166109.1  CG8205-RB, transcript variant B (fus), mRNA 
0   NM_166107.1  CG8205-RE, transcript variant E (fus), mRNA 
0   NM_079952.2  CG8205-RD, transcript variant D (fus), mRNA 
0   NM_165540.2  CG2140-RA, transcript variant A (Cyt-b5), mRNA 
0   NM_136450.2  CG2140-RB, transcript variant B (Cyt-b5), mRNA 
0   NM_132569.1  CG11245-RA (CG11245), mRNA 
0   NM_135651.2  CG4751-RA (CG4751), mRNA 
0   NM_132683.1  CG12177-RA (CG12177), mRNA 
0   NM_135480.2  CG4592-RA (CG4592), mRNA 
0   NM_057257.3  CG7664-RA (crp), mRNA 
0   NM_170326.2  CG31068-RA (CG31068), mRNA 
0   NM_001043268.1  CG31201-RB (GluRIIE), mRNA 
0   NM_141325.1  CG2091-RA (CG2091), mRNA 
0   NM_079543.2  CG1257-RA (alpha-Est3), mRNA 
0   NM_001043207.1  CG41467-RB, transcript variant B (CG41467), mRNA 
0   NM_143947.2  CG11686-RA (CG11686), mRNA 
0   NM_132221.2  CG2129-RA (CG2129), mRNA 
0   NM_176556.1  CG33106-RA, transcript variant A (mask), mRNA 
0   NM_176557.1  CG33106-RB, transcript variant B (mask), mRNA 
0   NM_136826.1  CG7741-RA (CG7741), mRNA 
0   NM_138181.1  CG13882-RA (CG13882), mRNA 
0   NM_141371.2  CG15592-RA (Osi9), mRNA 
0   NM_206008.1  CG33316-RB, transcript variant B (CG33316), mRNA 
0   NM_206007.1  CG33316-RA, transcript variant A (CG33316), mRNA 
0   NM_078722.2  CG17941-RA (ds), mRNA 
0   NM_139465.1  CG16762-RA (CG16762), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
 
DB
++ 
DC
++ 
DM
+- 
VM
+- 
VB
 
Caspase-3 signal
N
 
DB
++ 
DC
++ 
DM
 
VM
 
VB
 
Dcompartment   Penetrance
   

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.