National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 9115R-2 
 Symbol mtm  Full Name myotubularin 
 CG No CG9115  Old CG No CG9115 
 Synonyms MTM1, CG9115, unnamed, dMTMH1, mtm 
 Accession No (Link to NCBI) NM_078765.2 
 Inserted Chr. ll 
 Insertional Mutation  lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Swarup S, Pradhan-Sundd T, Verheyen EM.
Genome-wide identification of phospho-regulators of Wnt signaling in Drosophila.
Development (2015) 142(8) 1502-15 [ PubMed ID = 25852200 ] [ RRC reference ]

Rauskolb C, Pan G, Reddy BV, Oh H, Irvine KD.
Zyxin links fat signaling to the hippo pathway.
PLoS Biol (2011) 9(6) e1000624 [ PubMed ID = 21666802 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgAGCAGCAACTCTCTGGACAGC 
 Primer Seq. 3'
aatctagaggtaccCAGCCTCCGTTACCGTTCACA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 AGCAGCAACT CTCTGGACAG CAGCTCCAAG TCCAGTNTCG CTGGGCTCCA AGCACGGTGG 
0061 CGGAGAAAAC GGCATTCTGC GGGACACGCC CTTCGGCTAT CTGGAGGGCG AGGAGGACCA 
0121 GGACCAGAAG AACGACGTGA CCTACGTGTG TCCGTACCGC GGCCCCGTCT TCGGCGCTCT 
0181 TACCATAACC AACTACCGTC TGTACTTCCG GTCGCTTCCC CTGCGGGATC AGGANGCCGC 
0241 CCGTCGTCGT CGACGTGCCT CTgGGCGTGA TCGCGCGTGT GGAGAAGABT GGAGGTGCCA 
0301 CGTCTCGCGG TGAGAACTCG TACGGCATCG AGATTTTCTG CAAGGACATG CGAAACCTNC 
0361 GATTCGCCCA CAAGCAGCAG AATCATTCGC GGAGGACGGT GTTTGAGAAA CTGCAGNCCA 
0421 ACGCCTTTCC GCTCTCGTAC AGTGGGCGCC TCTTTgCATT CGCCCACgNC GCGGCCAACT 
0481 CTGTGAACGG TAACGGACGG CTg 
 in silico PCR Fragment
0001 AGCAGCAACT CTCTGGACAG CAGCTCCAAG TCCAGT-TCG CTGGGCTCCA AGCACGGTGG 
0061 CGGAGAAAAC GGCATTCTGC GGGACACGCC CTTCGGCTAT CTGGAGGGCG AAGAGGACCA 
0121 GGACCAGAAG AACGACGTGA CCTACGTGTG TCCGTACCGC GGCCCCGTCT TCGGCGCTCT 
0181 TACCATAACC AACTACCGTC TGTACTTCCG GTCGCTTCCC CTGCGGGATC AGGA-GCCGC 
0241 CCGTCGTCGT CGACGTGCCT CTGGGCGTGA TCGCGCGTGT GGAGAAGATT GGAGGTGCCA 
0301 CGTCTCGCGG TGAGAACTCG TACGGCATCG AGATTTTCTG CAAGGACATG CGAAACCTGC 
0361 GATTCGCCCA CAAGCAGCAG AATCATTCGC GGAGGACGGT GTTTGAGAAA CTGCAGGCCA 
0421 ACGCCTTTCC GCTCTCGTAC AGTGGGCGCC TCTTTGCATT CGCCCACGCC GCGGCCAACT 
0481 CTGTGAACGG TAACGGA-GG CTG 
 Assemble Data

9115R-2.IR_full       1   AGCAGCAACTCTCTGGACAGCAGCTCCAAGTCCAGTNTCGCTGGGCTCCAAGCACGGTGG 60
                          |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
9115R-2.in silico     1   AGCAGCAACTCTCTGGACAGCAGCTCCAAGTCCAGT-TCGCTGGGCTCCAAGCACGGTGG 60


9115R-2.IR_full       61  CGGAGAAAACGGCATTCTGCGGGACACGCCCTTCGGCTATCTGGAGGGCGAGGAGGACCA 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||
9115R-2.in silico     61  CGGAGAAAACGGCATTCTGCGGGACACGCCCTTCGGCTATCTGGAGGGCGAAGAGGACCA 120


9115R-2.IR_full       121 GGACCAGAAGAACGACGTGACCTACGTGTGTCCGTACCGCGGCCCCGTCTTCGGCGCTCT 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9115R-2.in silico     121 GGACCAGAAGAACGACGTGACCTACGTGTGTCCGTACCGCGGCCCCGTCTTCGGCGCTCT 180


9115R-2.IR_full       181 TACCATAACCAACTACCGTCTGTACTTCCGGTCGCTTCCCCTGCGGGATCAGGANGCCGC 240
                          |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||
9115R-2.in silico     181 TACCATAACCAACTACCGTCTGTACTTCCGGTCGCTTCCCCTGCGGGATCAGGA-GCCGC 240


9115R-2.IR_full       241 CCGTCGTCGTCGACGTGCCTCTGGGCGTGATCGCGCGTGTGGAGAAGABTGGAGGTGCCA 300
                          |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||
9115R-2.in silico     241 CCGTCGTCGTCGACGTGCCTCTGGGCGTGATCGCGCGTGTGGAGAAGATTGGAGGTGCCA 300


9115R-2.IR_full       301 CGTCTCGCGGTGAGAACTCGTACGGCATCGAGATTTTCTGCAAGGACATGCGAAACCTNC 360
                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
9115R-2.in silico     301 CGTCTCGCGGTGAGAACTCGTACGGCATCGAGATTTTCTGCAAGGACATGCGAAACCTGC 360


9115R-2.IR_full       361 GATTCGCCCACAAGCAGCAGAATCATTCGCGGAGGACGGTGTTTGAGAAACTGCAGNCCA 420
                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||
9115R-2.in silico     361 GATTCGCCCACAAGCAGCAGAATCATTCGCGGAGGACGGTGTTTGAGAAACTGCAGGCCA 420


9115R-2.IR_full       421 ACGCCTTTCCGCTCTCGTACAGTGGGCGCCTCTTTGCATTCGCCCACGNCGCGGCCAACT 480
                          |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||
9115R-2.in silico     421 ACGCCTTTCCGCTCTCGTACAGTGGGCGCCTCTTTGCATTCGCCCACGCCGCGGCCAACT 480


9115R-2.IR_full       481 CTGTGAACGGTAACGGACGGCTG 503
                          ||||||||||||||||| |||||
9115R-2.in silico     481 CTGTGAACGGTAACGGA-GGCTG 503

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_078765.2  CG9115-RA (mtm), mRNA 
0   NM_079810.4  CG12878-RA, transcript variant A (btz), mRNA 
0   NM_170350.1  CG12878-RB, transcript variant B (btz), mRNA 
0   NM_140554.1  CG12486-RA (CG12486), mRNA 
0   NM_167940.1  CG32305-RA (CG32305), mRNA 
0   NM_079138.1  CG2692-RA (gsb-n), mRNA 
0   NM_139778.2  CG10274-RA (CG10274), mRNA 
0   NM_170324.1  CG31064-RB, transcript variant B (CG31064), mRNA 
0   NM_136513.1  CG11508-RA, transcript variant A (CG11508), mRNA 
0   NM_165588.1  CG11508-RB, transcript variant B (CG11508), mRNA 
0   NM_057551.3  CG13521-RA, transcript variant A (robo), mRNA 
0   NM_166543.1  CG13521-RB, transcript variant B (robo), mRNA 
0   NM_139604.2  CG14998-RC, transcript variant C (CG14998), mRNA 
0   NM_168061.2  CG14998-RB, transcript variant B (CG14998), mRNA 
0   NM_168064.2  CG14998-RA, transcript variant A (CG14998), mRNA 
0   NM_168062.2  CG14998-RE, transcript variant E (CG14998), mRNA 
0   NM_176739.1  CG33173-RA (CG33173), mRNA 
0   NM_168063.2  CG14998-RD, transcript variant D (CG14998), mRNA 
0   NM_079105.2  CG4084-RA (l(2)not), mRNA 
0   NM_138175.2  CG7020-RA (DIP2), mRNA 
0   NM_166906.1  CG14801-RA, transcript variant A (CG14801), mRNA 
0   NM_166907.1  CG14801-RC, transcript variant C (CG14801), mRNA 
0   NM_139677.1  CG13707-RA (CG13707), mRNA 
0   NM_136420.2  CG11086-RA (Gadd45), mRNA 
0   12  NM_132235.2  CG32717-RB, transcript variant B (sdt), mRNA 
0   12  NM_206653.1  CG32717-RE, transcript variant E (sdt), mRNA 
0   10  NM_057374.2  CG3722-RA (shg), mRNA 
0   NM_079471.2  CG18023-RA, transcript variant A (Eip78C), mRNA 
0   NM_168892.1  CG18023-RB, transcript variant B (Eip78C), mRNA 
0   NM_078993.2  CG8604-RA (Amph), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.