National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 9107R-2 
 Symbol CG9107  Full Name CG9107 
 CG No CG9107  Old CG No CG9107 
 Synonyms CG9107 
 Accession No (Link to NCBI) NM_164673.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Ohhara Y, Nakamura A, Kato Y, Yamakawa-Kobayashi K.
Chaperonin TRiC/CCT supports mitotic exit and entry into endocycle in Drosophila.
PLoS Genet (2019) 15(4) e1008121 [ PubMed ID = 31034473 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATGCGGGAGCACTTCATCCGT 
 Primer Seq. 3'
aatctagaggtaccATTGCGACCCTCCTTGCCGAC 
 Predicted Fragment Size
519 
 IR fragment full Seq
0001 NTGCGGGAGC CCCTTCATCC CGTCTGATGG GATCCCAACA ANACCGAAGG GANCGCACAC 
0061 TCTTTTCTGC TCAACGTGCC GCCCTACGTG ACAGAGGACA GCCTGCGCAC GGTCTTCGGC 
0121 CGGGCGGGGA GCATCGAGGC CGTGGAGTTC GCCGCCAAAC CGGGCAAGGA GGAGACCATC 
0181 AAGTGGTACG AGGGCACCGG CNGAACCCTT CTCCAACACT CGTCCGCCCT TCGTCTTCAA 
0241 GGTGGCCTAC ATAGTGTTCG AGAAGAACAG CAGCATCGGC AACGGCGCTG GCACTAAAGA 
0301 GCATTGACCT GTTCAACAGC AGCGGCGAGT GCATCGTCAA GACCGGCATG GGAGCTGTGG 
0361 NCACGAGGAG TACGACTGCA ATTACCTGCT GGATGCGCAA AAGACGAAGC TACAGATCAG 
0421 GCAAGTACAT GGCCGGCTTA CGACAAGAGG GAGCGAGCGG CGGCACAGGC GGCCAAGACC 
0481 GGAGATGGCC GAcgNCGACG GATGGGTCAC CGTCGGCAAG GAGGGTCGCA AT 
 in silico PCR Fragment
0001 ATGCGGGAG- CACTTCAT-C CGTCTGAT-G GATCCCAACA A-ACCGAAGG GA-CGCACAC 
0061 TC-TTTCTGC TCAACGTGCC GCCCTACGTG ACAGAGGACA GCCTGCGCAC GGTCTTCGGC 
0121 CGGGCGGGGA GCATCGAGGC CGTGGAGTTC GCCGCCAAAC CGGGCAAGGA GGAGACCATC 
0181 AAGTGGTACG AGGGCACCGG C-GAACCCTT CTCCAACACT CGTCCGCCCT TCGTCTTCAA 
0241 GGTGGCCTAC ATAGTGTTCG AGAAGAACAG CAGCATCGGC AA-GGCGCTG GCACTAAAGA 
0301 GCATTGACCT GTTCAACAGC AGCGGCGAGT GCATCGTCAA GACCGGCAT- GGAGCTGTGG 
0361 -CACGAGGAG TACGACTGCA ATTACCTGCT GGATGCGCAA AAGACGAAGC TACAGATCA- 
0421 GCAAGTACAT GGCCGGC-TA CGACAAGAGG GAGCGAGCGG CGGCACAGGC GGCCAAGACC 
0481 GGAGA-GGCC GACGCCGACG GATGGGTCAC CGTCGGCAAG GAGGGTCGCA AT 
 Assemble Data

9107R-2.IR_full        1   TGCGGGAGCCCCTTCATCCCGTCTGATGGGATCCCAACAANACCGAAGGGANCGCACAC 59
                           |||||||| | |||||| ||||||||| |||||||||||| |||||||||| |||||||
9107R-2.in silico      1   TGCGGGAG-CACTTCAT-CCGTCTGAT-GGATCCCAACAA-ACCGAAGGGA-CGCACAC 59


9107R-2.IR_full       61  TCTTTTCTGCTCAACGTGCCGCCCTACGTGACAGAGGACAGCCTGCGCACGGTCTTCGGC 119
                          || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9107R-2.in silico     61  TC-TTTCTGCTCAACGTGCCGCCCTACGTGACAGAGGACAGCCTGCGCACGGTCTTCGGC 119


9107R-2.IR_full       121 CGGGCGGGGAGCATCGAGGCCGTGGAGTTCGCCGCCAAACCGGGCAAGGAGGAGACCATC 179
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9107R-2.in silico     121 CGGGCGGGGAGCATCGAGGCCGTGGAGTTCGCCGCCAAACCGGGCAAGGAGGAGACCATC 179


9107R-2.IR_full       181 AAGTGGTACGAGGGCACCGGCNGAACCCTTCTCCAACACTCGTCCGCCCTTCGTCTTCAA 239
                          ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||
9107R-2.in silico     181 AAGTGGTACGAGGGCACCGGC-GAACCCTTCTCCAACACTCGTCCGCCCTTCGTCTTCAA 239


9107R-2.IR_full       241 GGTGGCCTACATAGTGTTCGAGAAGAACAGCAGCATCGGCAACGGCGCTGGCACTAAAGA 299
                          |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||
9107R-2.in silico     241 GGTGGCCTACATAGTGTTCGAGAAGAACAGCAGCATCGGCAA-GGCGCTGGCACTAAAGA 299


9107R-2.IR_full       301 GCATTGACCTGTTCAACAGCAGCGGCGAGTGCATCGTCAAGACCGGCATGGGAGCTGTGG 359
                          ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||
9107R-2.in silico     301 GCATTGACCTGTTCAACAGCAGCGGCGAGTGCATCGTCAAGACCGGCAT-GGAGCTGTGG 359


9107R-2.IR_full        361 CACGAGGAGTACGACTGCAATTACCTGCTGGATGCGCAAAAGACGAAGCTACAGATCAG 418
                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| 
9107R-2.in silico      361 CACGAGGAGTACGACTGCAATTACCTGCTGGATGCGCAAAAGACGAAGCTACAGATCA- 418


9107R-2.IR_full       421 GCAAGTACATGGCCGGCTTACGACAAGAGGGAGCGAGCGGCGGCACAGGCGGCCAAGACC 478
                          ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||
9107R-2.in silico     421 GCAAGTACATGGCCGGC-TACGACAAGAGGGAGCGAGCGGCGGCACAGGCGGCCAAGACC 478


9107R-2.IR_full       481 GGAGATGGCCGACGNCGACGGATGGGTCACCGTCGGCAAGGAGGGTCGCAAT 530
                          ||||| |||||||| |||||||||||||||||||||||||||||||||||||
9107R-2.in silico     481 GGAGA-GGCCGACGCCGACGGATGGGTCACCGTCGGCAAGGAGGGTCGCAAT 530

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   501  NM_164673.1  CG9107-RA, transcript variant A (CG9107), mRNA 
100   501  NM_135137.2  CG9107-RB, transcript variant B (CG9107), mRNA 
0   NM_079298.2  CG7636-RA (mRpL2), mRNA 
0   NM_139921.2  CG7972-RA (mus301), mRNA 
0   NM_134725.1  CG4552-RA (CG4552), mRNA 
0   NM_080323.2  CG10798-RA (dm), mRNA 
0   NM_141281.2  CG2087-RA (PEK), mRNA 
0   NM_080047.2  CG8491-RA (kto), mRNA 
0   NM_001042889.1  CG6105-RC, transcript variant C (l(2)06225), mRNA 
0   NM_001042888.1  CG6105-RB, transcript variant B (l(2)06225), mRNA 
0   NM_143778.2  CG6105-RA, transcript variant A (l(2)06225), mRNA 
0   NM_080332.2  CG11427-RA (rb), mRNA 
0   NM_001043108.1  CG34099-RA, transcript variant A (Mkp), mRNA 
0   NM_001043109.1  CG34140-RA, transcript variant A (CG34140), mRNA 
0   NM_001043107.1  CG34099-RB, transcript variant B (Mkp), mRNA 
0   NM_143027.2  CG5805-RA (CG5805), mRNA 
0   10  NM_166125.2  CG18255-RA, transcript variant A (Strn-Mlck), mRNA 
0   NM_166126.1  CG18255-RC, transcript variant C (Strn-Mlck), mRNA 
0   NM_168999.2  CG9805-RB, transcript variant B (eIF3-S10), mRNA 
0   NM_141213.2  CG9805-RA, transcript variant A (eIF3-S10), mRNA 
0   NM_165716.1  CG10536-RA, transcript variant A (cbx), mRNA 
0   NM_080149.2  CG10536-RB, transcript variant B (cbx), mRNA 
0   NM_130615.2  CG4313-RA, transcript variant A (CG4313), mRNA 
0   NM_001038735.1  CG4313-RB, transcript variant B (CG4313), mRNA 
0   NM_144447.1  CG18870-RA (CG18870), mRNA 
0   NM_166127.1  CG18255-RF, transcript variant F (Strn-Mlck), mRNA 
0   NM_057666.3  CG10922-RA, transcript variant A (La), mRNA 
0   NM_165326.1  CG10922-RB, transcript variant B (La), mRNA 
0   NM_132996.2  CG5675-RA (X11L), mRNA 
0   NM_176374.1  CG4761-RA (knrl), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.