National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 9093R-2 
 Symbol Tsp26A  Full Name Tetraspanin 26A 
 CG No CG9093  Old CG No CG9093 
 Synonyms CG9093, Dm.Tsp26A, Tsp26A, Tetraspanin 26A 
 Accession No (Link to NCBI) NM_078763.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
[Please submit your publication]
Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS One (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || silico     1   GAAATCAGCTGCTGTCTGAAGTACCTTTTGTTCGCCAGCAATGTGATCCTGTGGCTC-TC 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  GGCCCTGCTGGTCCTCTCCGTTGGCATCTGGGCCTGGAGCGAGAAGGGCATGTTCCGCAA 120

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 CATTGCGCGGCTGCACTTCATCGCCCTGGACCCGGCCTTCGTCCTGATCATCCTGGGAGG 180

                          ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| silico     181 CGTCACCTTCCTACTGGGCTTCATGGGCAGCGTGGGC-GCCTTGCGCGAGAACACCTGCC 240

                          |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 TCCTGGGGGCGTACGCCATCTTCTTGAGTGTCTTGCTTATCGCAGAGATCGGCTTCTGTG 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 CCGTGGCCTTCGTGCTCAAGGACAAGGGCTGGATCAAAGACCAGGCCACCGAGGGACTCA 360

                          |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| silico     361 AGGCCTTCATTCGCCACTATCGCGAGGACGCAGACCAGCAGAATCTCATTGATTGGATCC 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 AGGAGGATTGGTTGCAGTGTTGCGGCATTGATGGTCCCAAGGACTGGGACAGCAACAACT 480

9093R-2.IR_full       481 ACTTCAATTGCTCGTCTATNGN 502
                          ||||||||||||||||||| | silico     481 ACTTCAATTGCTCGTCTATCGC 502

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_078763.1  CG9093-RA (Tsp26A), mRNA 
0   NM_137877.2  CG30265-RA (CG30265), mRNA 
0   NM_137196.1  CG12964-RA (CG12964), mRNA 
0   NM_001014464.1  CG10033-RJ, transcript variant J (for), mRNA 
0   NM_134319.3  CG10033-RD, transcript variant D (for), mRNA 
0   NM_058142.3  CG10033-RE, transcript variant E (for), mRNA 
0   NM_205907.1  CG10033-RG, transcript variant G (for), mRNA 
0   NM_058141.3  CG10033-RC, transcript variant C (for), mRNA 
0   NM_205905.1  CG10033-RF, transcript variant F (for), mRNA 
0   NM_141145.1  CG14455-RA (CG14455), mRNA 
0   NM_166105.1  CG8205-RC, transcript variant C (fus), mRNA 
0   NM_079952.2  CG8205-RD, transcript variant D (fus), mRNA 
0   NM_166108.1  CG8205-RF, transcript variant F (fus), mRNA 
0   NM_166107.1  CG8205-RE, transcript variant E (fus), mRNA 
0   NM_167903.1  CG7955-RB, transcript variant B (CG7955), mRNA 
0   NM_167902.1  CG7955-RA, transcript variant A (CG7955), mRNA 
0   NM_139377.2  CG7955-RC, transcript variant C (CG7955), mRNA 
0   NM_136675.1  CG1625-RA (CG1625), mRNA 
0   NM_143298.1  CG3368-RA (CG3368), mRNA 
0   NM_136043.2  CG10413-RA (CG10413), mRNA 
0   10  NM_079585.2  CG4591-RA (Tsp86D), mRNA 
0   NM_133002.1  CG5800-RA (CG5800), mRNA 
0   NM_134534.2  CG17052-RA (CG17052), mRNA 
0   NM_132081.2  CG15896-RA (CG15896), mRNA 
0   NM_143236.1  CG14248-RA (CG14248), mRNA 
0   NM_141542.1  CG11718-RA (CG11718), mRNA 
0   NM_137484.2  CG17530-RA (GstE6), mRNA 
0   NM_132385.2  CG2967-RA (CG2967), mRNA 
0   NM_132302.3  CG7055-RA (dalao), mRNA 
0   NM_135779.2  CG5648-RA (Prosalpha6T), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.