National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 9064R-3 
 Symbol Ucp4C  Full Name Ucp4C 
 CG No CG9064  Old CG No CG9064 
 Synonyms dmUCP4c, DmUCP4C, CG9064, anon-WO03061681.2, anon-WO03061681.1, anon-WO03037362.7, anon-WO0242455.4, anon-WO0242455.3, anon-WO02079478.2, anon-WO02079478.1, Ucp4C 
 Accession No (Link to NCBI) NM_135132.2 
 Inserted Chr. ll 
 Insertional Mutation  lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCGCGATTTCCGCCAACAAACG 
 Primer Seq. 3'
aatctagaggtaccCACCATGCTGTTCACCCGCAC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CGCGATTTCC GCCAACAAAC GTCGCTGATC CACTAACCGC ACGCAATCTG TTCCAGCTCT 
0061 ACGTCAACAC CTTCATTGGA GCCACATCTG GCCGAGTCGT GTGTCTTCCC ATTGGACGTG 
0121 GCCAAGACCC GGATGCAGGT AGATGGCGAG CAGGCCAAGA AGACGGGTAA AGCGATGCCA 
0181 ACTTTCCGGG CAACTCTTAC CAACATGATC CGAGTGGAGG GATTCAAGTC GCTCTACGCC 
0241 GGCTTCTCGG CAATGGTGAC CCGAAACTTT ATCTTCAACT CGTTACGTGT TGTTCTCTAC 
0301 GACGTTTTCC GGCGCCCTTT TCTCTACCAG AACGAGCGGA ACGAGGAAGT GCTCAAGATC 
0361 TACATGGCGC TGGGGATGCA GCTTCACCGC AGGCTGCATT GCCCAGGCAC TGGCCAATTC 
0421 CCTTTGACAT CGTCAAGGTG CNGAATGCAG ACGGAAGGAC GCCGCCGCCA GCTGGGCTAT 
0481 GATGTGCGGG TGAACAGCAT GGTG 
 in silico PCR Fragment
0001 CGCGATTTCC GCCAACAAAC GTCGCTGATC CACTAACCGC ACGCAATCTG TTCCAGCTCT 
0061 ACGTCAACAC CTTCATTGGA GCCA-ATCTG GCCGAGTCGT GTGTCTTCCC ATTGGACGTG 
0121 GCCAAGACCC GGATGCAGGT AGATGGCGAG CAGGCCAAGA AGACGGGTAA AGCGATGCCA 
0181 ACTTTCCGGG CAACTCTTAC CAACATGATC CGAGTGGAGG GATTCAAGTC GCTCTACGCC 
0241 GGCTTCTCGG CAATGGTGAC CCGAAACTTT ATCTTCAACT CGTTACGTGT TGTTCTCTAC 
0301 GACGTTTTCC GGCGCCCTTT TCTCTACCAG AACGAGCGGA ACGAGGAAGT GCTCAAGATC 
0361 TACATGGCGC T-GGGATGCA GCTTCACCGC AGGCTGCATT GCCCAGGCAC TGGCCAA-TC 
0421 CCTTTGACAT CGTCAAGGTG C-GAATGCAG ACGGAAGGAC GCCGCCGCCA GCTGGGCTAT 
0481 GATGTGCGGG TGAACAGCAT GGTG 
 Assemble Data

9064R-3.IR_full       1   CGCGATTTCCGCCAACAAACGTCGCTGATCCACTAACCGCACGCAATCTGTTCCAGCTCT 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9064R-3.in silico     1   CGCGATTTCCGCCAACAAACGTCGCTGATCCACTAACCGCACGCAATCTGTTCCAGCTCT 60


9064R-3.IR_full       61  ACGTCAACACCTTCATTGGAGCCACATCTGGCCGAGTCGTGTGTCTTCCCATTGGACGTG 120
                          |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||
9064R-3.in silico     61  ACGTCAACACCTTCATTGGAGCCA-ATCTGGCCGAGTCGTGTGTCTTCCCATTGGACGTG 120


9064R-3.IR_full       121 GCCAAGACCCGGATGCAGGTAGATGGCGAGCAGGCCAAGAAGACGGGTAAAGCGATGCCA 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9064R-3.in silico     121 GCCAAGACCCGGATGCAGGTAGATGGCGAGCAGGCCAAGAAGACGGGTAAAGCGATGCCA 180


9064R-3.IR_full       181 ACTTTCCGGGCAACTCTTACCAACATGATCCGAGTGGAGGGATTCAAGTCGCTCTACGCC 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9064R-3.in silico     181 ACTTTCCGGGCAACTCTTACCAACATGATCCGAGTGGAGGGATTCAAGTCGCTCTACGCC 240


9064R-3.IR_full       241 GGCTTCTCGGCAATGGTGACCCGAAACTTTATCTTCAACTCGTTACGTGTTGTTCTCTAC 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9064R-3.in silico     241 GGCTTCTCGGCAATGGTGACCCGAAACTTTATCTTCAACTCGTTACGTGTTGTTCTCTAC 300


9064R-3.IR_full       301 GACGTTTTCCGGCGCCCTTTTCTCTACCAGAACGAGCGGAACGAGGAAGTGCTCAAGATC 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9064R-3.in silico     301 GACGTTTTCCGGCGCCCTTTTCTCTACCAGAACGAGCGGAACGAGGAAGTGCTCAAGATC 360


9064R-3.IR_full       361 TACATGGCGCTGGGGATGCAGCTTCACCGCAGGCTGCATTGCCCAGGCACTGGCCAATTC 420
                          ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||
9064R-3.in silico     361 TACATGGCGCT-GGGATGCAGCTTCACCGCAGGCTGCATTGCCCAGGCACTGGCCAA-TC 420


9064R-3.IR_full       421 CCTTTGACATCGTCAAGGTGCNGAATGCAGACGGAAGGACGCCGCCGCCAGCTGGGCTAT 480
                          ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||
9064R-3.in silico     421 CCTTTGACATCGTCAAGGTGC-GAATGCAGACGGAAGGACGCCGCCGCCAGCTGGGCTAT 480


9064R-3.IR_full       481 GATGTGCGGGTGAACAGCATGGTG 504
                          ||||||||||||||||||||||||
9064R-3.in silico     481 GATGTGCGGGTGAACAGCATGGTG 504

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_135132.2  CG9064-RA (Ucp4C), mRNA 
0.41   NM_142917.2  CG10300-RA (CG10300), mRNA 
0   NM_079237.1  CG4321-RA (Cyp4d8), mRNA 
0   NM_079683.2  CG4550-RA (ninaE), mRNA 
0   NM_136620.2  CG8008-RA (CG8008), mRNA 
0   NM_167318.1  CG1786-RA (Cyp318a1), mRNA 
0   NM_130500.2  CG5254-RA (CG5254), mRNA 
0   NM_132175.2  CG12155-RA (CG12155), mRNA 
0   NM_057420.3  CG7875-RA (trp), mRNA 
0   NM_135651.2  CG4751-RA (CG4751), mRNA 
0   NM_168400.1  CG6611-RB, transcript variant B (ect), mRNA 
0   NM_079967.4  CG6611-RA, transcript variant A (ect), mRNA 
0   NM_167265.1  CG2061-RC, transcript variant C (CG2061), mRNA 
0   NM_132454.4  CG2061-RA, transcript variant A (CG2061), mRNA 
0   NM_167264.1  CG2061-RB, transcript variant B (CG2061), mRNA 
0   NM_139911.1  CG8038-RA (CG8038), mRNA 
0   NM_139932.2  CG7366-RA (CG7366), mRNA 
0   NM_080499.2  CG6898-RA (Zip3), mRNA 
0   NM_206053.1  CG18654-RD, transcript variant D (Dgk), mRNA 
0   NM_078930.2  CG18654-RA, transcript variant A (Dgk), mRNA 
0   NM_165568.1  CG18654-RB, transcript variant B (Dgk), mRNA 
0   NM_139736.1  CG18586-RA (CG18586), mRNA 
0   NM_140925.2  CG7323-RA (CG7323), mRNA 
0   12  NM_135426.2  CG9582-RA (CG9582), mRNA 
0   NM_167676.1  CG12529-RB, transcript variant B (Zw), mRNA 
0   NM_078687.1  CG12529-RA, transcript variant A (Zw), mRNA 
0   NM_140685.4  CG3799-RA, transcript variant A (CG3799), mRNA 
0   NM_168706.1  CG3799-RC, transcript variant C (CG3799), mRNA 
0   NM_168705.1  CG3799-RB, transcript variant B (CG3799), mRNA 
0   14  NM_080094.2  CG9696-RA, transcript variant A (dom), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.