National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 9048R-3 
 Symbol Vm26Aa  Full Name Vitelline membrane 26Aa 
 CG No CG9048  Old CG No CG9048 
 Synonyms sV17, VM26A.1, Vm26A.1, Vm26A1, Vm26A, TU-2, CG9048, Vm26Aa, VM26Aa 
 Accession No (Link to NCBI) NM_057435.2 
 Inserted Chr. lll 
 Insertional Mutation  lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS One (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTGAAATCCTTCGTGTGCATCG 
 Primer Seq. 3'
aatctagaggtaccGTACTGGTAGCCATAGGTCTG 
 Predicted Fragment Size
422 
 IR fragment full Seq
0001 TGAAATCCTT CGTGTGCATC GCTCTGGTCG CCTTCGCCGC CGCCGCTCTG GCTTCGCCCA 
0061 CCAACGTGGC TTCgGCCACC GGCTCCACTG GCTCCTCGGT GACCACCCAG GACGGAGAGC 
0121 TGGAGGGAGT GACCGGACAG GGATTCGGTG ACCTGACCCG TACTCCGTAA GTCTGCCTAC 
0181 GGCGGCAGcT CCGGCGGCTA TGGCGGCTCC AGCATCCCAG CTCCTCCCTG CCCCAAGAAC 
0241 TACCTGTTCA GCTGCCAGCC CAACCTTGCC CCCGTGCCAT GCACGCGCTC CAGCTCCCAG 
0301 CTACGGATCN GCCGGCGCCT ACTCCTCCCC GGTgGCCACC TACGTCGCCC CCAACTACGG 
0361 CgNGCCCCAG CACCAGCAGC AGCTGTACAG CGCCTACGTG CCCCAGACCT ATGGCTACCA 
0421 GTAC 
 in silico PCR Fragment
0001 TGAAATCCTT CGTGTGCATC GCTCTGGTCG CCTTCGCCGC CGCCGCTCTG GCTTCGCCCA 
0061 CCAACGTGGC TTCGGCCACC GGCTCCACTG GCTCCTCGGT GACCACCCAG GACGGAGAGC 
0121 TGGAGGGAGT GACCGGACAG GGATTCGGTG ACCTGACCCG T-CTCCGTAA GTCTGCCTAC 
0181 GGCGGCAGCT CCGGCGGCTA TGGCGGCTCC AGCATCCCAG CTCCTCCCTG CCCCAAGAAC 
0241 TACCTGTTCA GCTGCCAGCC CAACCTTGCC CCCGTGCCAT GCA-GCGCTC CAGCTCCCAG 
0301 CTACGGATCC GCCGGCGCCT ACTCCTCCCC GGTGGCCACC TACGTCGCCC CCAACTACGG 
0361 CGTGCCCCAG CACCAGCAGC AGCTGTACAG CGCCTACGTG CCCCAGACCT ATGGCTACCA 
0421 GTAC 
 Assemble Data

9048R-3.IR_full       1   TGAAATCCTTCGTGTGCATCGCTCTGGTCGCCTTCGCCGCCGCCGCTCTGGCTTCGCCCA 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9048R-3.in silico     1   TGAAATCCTTCGTGTGCATCGCTCTGGTCGCCTTCGCCGCCGCCGCTCTGGCTTCGCCCA 60


9048R-3.IR_full       61  CCAACGTGGCTTCGGCCACCGGCTCCACTGGCTCCTCGGTGACCACCCAGGACGGAGAGC 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9048R-3.in silico     61  CCAACGTGGCTTCGGCCACCGGCTCCACTGGCTCCTCGGTGACCACCCAGGACGGAGAGC 120


9048R-3.IR_full       121 TGGAGGGAGTGACCGGACAGGGATTCGGTGACCTGACCCGTACTCCGTAAGTCTGCCTAC 180
                          ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||
9048R-3.in silico     121 TGGAGGGAGTGACCGGACAGGGATTCGGTGACCTGACCCGT-CTCCGTAAGTCTGCCTAC 180


9048R-3.IR_full       181 GGCGGCAGCTCCGGCGGCTATGGCGGCTCCAGCATCCCAGCTCCTCCCTGCCCCAAGAAC 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9048R-3.in silico     181 GGCGGCAGCTCCGGCGGCTATGGCGGCTCCAGCATCCCAGCTCCTCCCTGCCCCAAGAAC 240


9048R-3.IR_full       241 TACCTGTTCAGCTGCCAGCCCAACCTTGCCCCCGTGCCATGCACGCGCTCCAGCTCCCAG 300
                          ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||
9048R-3.in silico     241 TACCTGTTCAGCTGCCAGCCCAACCTTGCCCCCGTGCCATGCA-GCGCTCCAGCTCCCAG 300


9048R-3.IR_full       301 CTACGGATCNGCCGGCGCCTACTCCTCCCCGGTGGCCACCTACGTCGCCCCCAACTACGG 360
                          ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||
9048R-3.in silico     301 CTACGGATCCGCCGGCGCCTACTCCTCCCCGGTGGCCACCTACGTCGCCCCCAACTACGG 360


9048R-3.IR_full       361 CGNGCCCCAGCACCAGCAGCAGCTGTACAGCGCCTACGTGCCCCAGACCTATGGCTACCA 420
                          || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9048R-3.in silico     361 CGTGCCCCAGCACCAGCAGCAGCTGTACAGCGCCTACGTGCCCCAGACCTATGGCTACCA 420


9048R-3.IR_full       421 GTAC 424
                          ||||
9048R-3.in silico     421 GTAC 424

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   404  NM_057435.2  CG9048-RA (Vm26Aa), mRNA 
4.95   20  38  35  NM_057437.2  CG9271-RA (Vm34Ca), mRNA 
3.71   15  11  NM_057436.2  CG9046-RA (Vm26Ab), mRNA 
1.98   12  13  NM_057755.2  CG16874-RA (Vm32E), mRNA 
0.24   NM_169823.1  CG7693-RB, transcript variant B (fray), mRNA 
0.24   NM_057960.3  CG7693-RA, transcript variant A (fray), mRNA 
0   NM_057382.2  CG16738-RA (slp1), mRNA 
0   NM_135541.1  CG13141-RA (CG13141), mRNA 
0   10  33  NM_080086.1  CG9930-RA (E5), mRNA 
0   17  NM_080020.3  CG11491-RE, transcript variant E (br), mRNA 
0   17  NM_166898.1  CG11491-RG, transcript variant G (br), mRNA 
0   NM_141844.2  CG14715-RA (CG14715), mRNA 
0   47  NM_079938.3  CG2102-RA (cas), mRNA 
0   NM_132797.2  CG9198-RA, transcript variant A (shtd), mRNA 
0   11  NM_057492.3  CG4114-RA (ex), mRNA 
0   NM_140610.2  CG13044-RA (CG13044), mRNA 
0   10  28  NM_132538.1  CG15737-RA (CG15737), mRNA 
0   10  NM_167559.1  CG32564-RA (CG32564), mRNA 
0   25  NM_057265.3  CG1264-RA (lab), mRNA 
0   22  NM_134519.1  CG11940-RA, transcript variant A (CG11940), mRNA 
0   18  NM_167686.1  CG11940-RB, transcript variant B (CG11940), mRNA 
0   55  NM_143409.1  CG11873-RA (CG11873), mRNA 
0   52  NM_206456.1  CG32466-RB, transcript variant B (rn), mRNA 
0   42  NM_141458.2  CG32466-RA, transcript variant A (rn), mRNA 
0   24  NM_079504.3  CG1133-RA (opa), mRNA 
0   NM_168124.1  CG10596-RC, transcript variant C (Msr-110), mRNA 
0   NM_168123.1  CG10596-RA, transcript variant A (Msr-110), mRNA 
0   NM_139716.2  CG10596-RB, transcript variant B (Msr-110), mRNA 
0   NM_140034.2  CG4641-RA (CG4641), mRNA 
0   NM_132453.1  CG2076-RA (CG2076), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.