National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 9046R-2 
 Symbol Vm26Ab  Full Name Vitelline membrane 26Ab 
 CG No CG9046  Old CG No CG9046 
 Synonyms sV23, fs(2)QJ42, VM26A.2, Dm sV23, Sv23, sV26, Vm26A, TU-4, sv23, CG9046, Vm26Ab 
 Accession No (Link to NCBI) NM_057436.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees semi-lethal 
 Map Viewer
 Reference
[Please submit your publication]
Cho Y, Lai CM, Lin KY, Hsu HJ.
A Targeted RNAi Screen Reveals Drosophila Female-Sterile Genes That Control the Size of Germline Stem Cell Niche During Development.
G3 (Bethesda) (2018) 8(7) 2345-2354 [ PubMed ID = 29764959 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS One (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCTTTGGTCACCTCCTCATCGC 
 Primer Seq. 3'
aatctagaggtaccGGCACGTACTGGGAGTAGGCA 
 Predicted Fragment Size
462 
 IR fragment full Seq
0001 CTTTGGTCAC CTCCTCATCG CCGGCCTCGT GGCCTTGTCC GCCGTGTCCT CGGAGACCAT 
0061 CCANGCTGCA GCCCACTCAG GGCATCCTCA TCCCCGCCCC GCTGGCCGAG AACATCCGTG 
0121 TGTCGCGTGC CGNCTACGGA GGATACGGCG CTGCCCCAGC CGCCCCATCG TACTCCGCCC 
0181 CAGCCGCTCC CGCTGCCCAG GCCTACTCTG CTCCCGCTGC CCCAGCCTAC TCCGCACCCG 
0241 CTGCTCCCGC CTACTCCGCA CCCGCTGCTC CTGCCTACTC TGCTCCCGCT GCCCCAGCTT 
0301 ACTCTGCCCC AGCCGCACCA GCTTACTCCG CACTCGCCTC CATTCCGTCG CCGCCGTGCC 
0361 CCAAGAACTA CCTGTTCAGC TGCCAGCCCT CCCTGCAGCC CGTGCCCTGC TCCGCCNCCA 
0421 GCTCAGTCCT ACGGATTCCG CCGGTGCCTA CTCCCAGTAC GTGCC 
 in silico PCR Fragment
0001 CTTTGGTCAC CTCCTCATCG CCGGCCTCGT GGCCTTGTCC GCCGTGTCCT CGGAGACCAT 
0061 CCA-GCTGCA GCCCACTCAG GGCATCCTCA TCCCCGCCCC GCTGGCCGAG AACATCCGTG 
0121 TGTCGCGTGC CGCCTACGGA GGATACGGCG CTGCCCCAGC CGCCCCATCG TACTCCGCCC 
0181 CAGCCGCTCC CGCTGCCCAG GCCTACTCTG CTCCCGCTGC CCCAGCCTAC TCCGCACCCG 
0241 CTGCTCCCGC CTACTCCGCA CCCGCTGCTC CTGCCTACTC TGCTCCCGCT GCCCCAGCTT 
0301 ACTCTGCCCC AGCCGCACCA GCTTACTCCG CACCCGCCTC CATTCCGTCG CCGCCGTGCC 
0361 CCAAGAACTA CCTGTTCAGC TGCCAGCCCT CCCTGCAGCC CGTGCCCTGC TCCGCC-CCA 
0421 GCTCAGTCCT ACGGA-TCCG CCGGTGCCTA CTCCCAGTAC GTGCC 
 Assemble Data

9046R-2.IR_full       1   CTTTGGTCACCTCCTCATCGCCGGCCTCGTGGCCTTGTCCGCCGTGTCCTCGGAGACCAT 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9046R-2.in silico     1   CTTTGGTCACCTCCTCATCGCCGGCCTCGTGGCCTTGTCCGCCGTGTCCTCGGAGACCAT 60


9046R-2.IR_full       61  CCANGCTGCAGCCCACTCAGGGCATCCTCATCCCCGCCCCGCTGGCCGAGAACATCCGTG 120
                          ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9046R-2.in silico     61  CCA-GCTGCAGCCCACTCAGGGCATCCTCATCCCCGCCCCGCTGGCCGAGAACATCCGTG 120


9046R-2.IR_full       121 TGTCGCGTGCCGNCTACGGAGGATACGGCGCTGCCCCAGCCGCCCCATCGTACTCCGCCC 180
                          |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||
9046R-2.in silico     121 TGTCGCGTGCCGCCTACGGAGGATACGGCGCTGCCCCAGCCGCCCCATCGTACTCCGCCC 180


9046R-2.IR_full       181 CAGCCGCTCCCGCTGCCCAGGCCTACTCTGCTCCCGCTGCCCCAGCCTACTCCGCACCCG 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9046R-2.in silico     181 CAGCCGCTCCCGCTGCCCAGGCCTACTCTGCTCCCGCTGCCCCAGCCTACTCCGCACCCG 240


9046R-2.IR_full       241 CTGCTCCCGCCTACTCCGCACCCGCTGCTCCTGCCTACTCTGCTCCCGCTGCCCCAGCTT 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9046R-2.in silico     241 CTGCTCCCGCCTACTCCGCACCCGCTGCTCCTGCCTACTCTGCTCCCGCTGCCCCAGCTT 300


9046R-2.IR_full       301 ACTCTGCCCCAGCCGCACCAGCTTACTCCGCACTCGCCTCCATTCCGTCGCCGCCGTGCC 360
                          ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||
9046R-2.in silico     301 ACTCTGCCCCAGCCGCACCAGCTTACTCCGCACCCGCCTCCATTCCGTCGCCGCCGTGCC 360


9046R-2.IR_full       361 CCAAGAACTACCTGTTCAGCTGCCAGCCCTCCCTGCAGCCCGTGCCCTGCTCCGCCNCCA 420
                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||
9046R-2.in silico     361 CCAAGAACTACCTGTTCAGCTGCCAGCCCTCCCTGCAGCCCGTGCCCTGCTCCGCC-CCA 420


9046R-2.IR_full       421 GCTCAGTCCTACGGATTCCGCCGGTGCCTACTCCCAGTACGTGCC 465
                          ||||||||||||||| |||||||||||||||||||||||||||||
9046R-2.in silico     421 GCTCAGTCCTACGGA-TCCGCCGGTGCCTACTCCCAGTACGTGCC 465

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
105.85  470  42  86  246  NM_057436.2  CG9046-RA (Vm26Ab), mRNA 
3.82   17  16  22  69  NM_057437.2  CG9271-RA (Vm34Ca), mRNA 
3.37   15  11  NM_057435.2  CG9048-RA (Vm26Aa), mRNA 
1.57   16  21  32  NM_206398.1  CG33255-RA (CG33255), mRNA 
1.35   16  10  NM_057755.2  CG16874-RA (Vm32E), mRNA 
0.45   14  76  173  NM_139653.1  CG11350-RB (CG11350), mRNA 
0.22   NM_140881.2  CG8786-RB (CG8786), mRNA 
0   22  NM_168798.1  CG32207-RA (CG32207), mRNA 
0   21  NR_001975.1  CR32205, miscRNA 
0   15  26  NM_135130.1  CG9050-RA (CG9050), mRNA 
0   180  NM_166936.1  CG32798-RA (CG32798), mRNA 
0   NM_132514.2  CG1837-RA (CG1837), mRNA 
0   NM_137371.2  CG6522-RA (CG6522), mRNA 
0   14  99  NM_136257.2  CG8677-RA (CG8677), mRNA 
0   14  89  NM_165363.1  CG31626-RB, transcript variant B (CG31626), mRNA 
0   14  89  NM_165362.1  CG31626-RA, transcript variant A (CG31626), mRNA 
0   NR_002490.1  CG31626-RA, transcript variant A (CG31626), mRNA, miscRNA 
0   NM_168799.1  CG32212-RA (CG32212), mRNA 
0   NM_166076.1  CG12424-RB, transcript variant B (CG12424), mRNA 
0   NM_137165.1  CG12424-RA, transcript variant A (CG12424), mRNA 
0   NM_166077.1  CG12424-RC, transcript variant C (CG12424), mRNA 
0   NM_078678.2  CG6500-RB, transcript variant B (Bx), mRNA 
0   NM_176758.1  CG6500-RC, transcript variant C (Bx), mRNA 
0   NM_167625.1  CG6500-RA, transcript variant A (Bx), mRNA 
0   NM_168462.1  CG11711-RB, transcript variant B (Mob1), mRNA 
0   NM_168461.2  CG11711-RA, transcript variant A (Mob1), mRNA 
0   NM_168460.1  CG11711-RD, transcript variant D (Mob1), mRNA 
0   NM_140217.1  CG11711-RC, transcript variant C (Mob1), mRNA 
0   NM_001038795.1  CG8683-RA (CG8683), mRNA 
0   NM_143284.2  CG6059-RA (CG6059), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
 
DB
+- 
DC
DM
 
VM
 
VB
 
Caspase-3 signal
N
 
DB
++ 
DC
++ 
DM
VM
VB
 
Dcompartment   Penetrance
   

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.