National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 9046R-1 
 Symbol Vm26Ab  Full Name Vitelline membrane 26Ab 
 CG No CG9046  Old CG No CG9046 
 Synonyms sV23, fs(2)QJ42, VM26A.2, Dm sV23, Sv23, sV26, Vm26A, TU-4, sv23, CG9046, Vm26Ab 
 Accession No (Link to NCBI) NM_057436.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees male lethal, female semi-lethal 
 Map Viewer
[Please submit your publication]
Cho Y, Lai CM, Lin KY, Hsu HJ.
A Targeted RNAi Screen Reveals Drosophila Female-Sterile Genes That Control the Size of Germline Stem Cell Niche During Development.
G3 (Bethesda) (2018) 8(7) 2345-2354 [ PubMed ID = 29764959 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS One (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   CTTTGGTCACCTCCTCATCGCCGGCCTCGTGGCCTTGTCCGCCGTGTCCTCGGAGACCAT 60

                          ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  CCA-GCTGCAGCCCACTCAGGGCATCCTCATCCCCGCCCCGCTGGCCGAGAACATCCGTG 120

                          |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| silico     121 TGTCGCGTGCCGCCTACGGAGGATACGGCGCTGCCCCAGCCGCCCCATCGTACTCCGCCC 180

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 CAGCCGCTCCCGCTGCCCAGGCCTACTCTGCTCCCGCTGCCCCAGCCTACTCCGCACCCG 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 CTGCTCCCGCCTACTCCGCACCCGCTGCTCCTGCCTACTCTGCTCCCGCTGCCCCAGCTT 300

                          ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| silico     301 ACTCTGCCCCAGCCGCACCAGCTTACTCCGCACCCGCCTCCATTCCGTCGCCGCCGTGCC 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| silico     361 CCAAGAACTACCTGTTCAGCTGCCAGCCCTCCCTGCAGCCCGTGCCCTGCTCCGCC-CCA 420

                          ||||||||||||||| ||||||||||||||||||||||||||||| silico     421 GCTCAGTCCTACGGA-TCCGCCGGTGCCTACTCCCAGTACGTGCC 465

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
105.85  470  42  86  246  NM_057436.2  CG9046-RA (Vm26Ab), mRNA 
3.82   17  16  22  69  NM_057437.2  CG9271-RA (Vm34Ca), mRNA 
3.37   15  11  NM_057435.2  CG9048-RA (Vm26Aa), mRNA 
1.57   16  21  32  NM_206398.1  CG33255-RA (CG33255), mRNA 
1.35   16  10  NM_057755.2  CG16874-RA (Vm32E), mRNA 
0.45   14  76  173  NM_139653.1  CG11350-RB (CG11350), mRNA 
0.22   NM_140881.2  CG8786-RB (CG8786), mRNA 
0   22  NM_168798.1  CG32207-RA (CG32207), mRNA 
0   21  NR_001975.1  CR32205, miscRNA 
0   15  26  NM_135130.1  CG9050-RA (CG9050), mRNA 
0   180  NM_166936.1  CG32798-RA (CG32798), mRNA 
0   NM_132514.2  CG1837-RA (CG1837), mRNA 
0   NM_137371.2  CG6522-RA (CG6522), mRNA 
0   14  99  NM_136257.2  CG8677-RA (CG8677), mRNA 
0   14  89  NM_165363.1  CG31626-RB, transcript variant B (CG31626), mRNA 
0   14  89  NM_165362.1  CG31626-RA, transcript variant A (CG31626), mRNA 
0   NR_002490.1  CG31626-RA, transcript variant A (CG31626), mRNA, miscRNA 
0   NM_168799.1  CG32212-RA (CG32212), mRNA 
0   NM_166076.1  CG12424-RB, transcript variant B (CG12424), mRNA 
0   NM_137165.1  CG12424-RA, transcript variant A (CG12424), mRNA 
0   NM_166077.1  CG12424-RC, transcript variant C (CG12424), mRNA 
0   NM_078678.2  CG6500-RB, transcript variant B (Bx), mRNA 
0   NM_176758.1  CG6500-RC, transcript variant C (Bx), mRNA 
0   NM_167625.1  CG6500-RA, transcript variant A (Bx), mRNA 
0   NM_168462.1  CG11711-RB, transcript variant B (Mob1), mRNA 
0   NM_168461.2  CG11711-RA, transcript variant A (Mob1), mRNA 
0   NM_168460.1  CG11711-RD, transcript variant D (Mob1), mRNA 
0   NM_140217.1  CG11711-RC, transcript variant C (Mob1), mRNA 
0   NM_001038795.1  CG8683-RA (CG8683), mRNA 
0   NM_143284.2  CG6059-RA (CG6059), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.