National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 9044R-1 
 Symbol CG9044  Full Name CG9044 
 CG No CG9044  Old CG No CG9044 
 Synonyms CT25972, CG9044 
 Accession No (Link to NCBI) NM_135127.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATCACCGAGCTGGCTAACCTG 
 Primer Seq. 3'
aatctagaggtaccTCGGCCGTCTTTAGCTCGTTC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 ATCACCGAGC TGGCTAANCC TGCTACGGCA GAACGGCGAC AAAATATTGA GCTCCGAATT 
0061 TACCTTGACG TTATCAGGTT CCCTGCTGCG TGCGCTAAAC GACTCCTTCA CCCTGATCGC 
0121 GGACACTGAA ATCGGAACTG GCGCGGGTTA CCTCCAGCCG CAGTCTTTTC AGGTGGTCAA 
0181 GCCCATCAAC GCCAAGTCCA GCGTCTTCCC CGACCTCCAG CTGGTCCACG ACTTTGTGCA 
0241 GAAAACGACG CTTTTGAAGC TGACCTACTT TCCCAGCGAA CACTATTTCG AGGGCGCCAT 
0301 CGACATAGCG AAGTTTCGAG CACTGCGCNC GCCTCGAGGT AAACAAAATC AACATCGGCC 
0361 AAGTTGTGGG CATCCAACCG CTGCGCGGCC AGCTGCAACA TTTGATCTGC GTAAAAAGCC 
0421 TTACCAGCGT GGACGACATT ATCACGCGCT GCGGCGGCGA CAACTCGAAT GGCTTTGTGT 
0481 GGAACGAGCT AAANGACGGC CGA 
 in silico PCR Fragment
0001 ATCACCGAGC TGGCTAA-CC TGCTACGGCA GAACGGCGAC AAAATATTGA GCTCCGAATT 
0061 TACCTTGACG TTATCAGGTT CCCTGCTGCG TGCGCTAAAC GACTCCTTCA CCCTGATCGC 
0121 GGACACTGAA ATCGGAACTG GCGCGGGTTA CCTCCAGCCG CAGTCTTTTC AGGTGGTCAA 
0181 GCCCATCAAC GCCAAGTCCA GCGTCTTCCC CGACCTCCAG CTTGTCCATG ACTTTGTGCA 
0241 GAAAACGACG CTTTTGAAGC TGACCTACTT TCCCAGCGAA CACTATTTTG AGGGCGCCAT 
0301 CGACATAGCG AAGTTTCGAG CACTGCGC-C GCCTCGAGGT AAACAAAATC AACATCGGCC 
0361 AAGTTGTGGG CATCCAACCG CTGCGCGGCC AGCTGCAACA TTTGATCTGC GTAAAAAGCC 
0421 TTACCAGCGT GGACGACATT ATCACGCGCT GCGGCGGCGA CAACTCGAAT GGCTTTGTGT 
0481 GGAACGAGCT AAA-GACGGC CGA 
 Assemble Data

9044R-1.IR_full       1   ATCACCGAGCTGGCTAANCCTGCTACGGCAGAACGGCGACAAAATATTGAGCTCCGAATT 60
                          ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||
9044R-1.in silico     1   ATCACCGAGCTGGCTAA-CCTGCTACGGCAGAACGGCGACAAAATATTGAGCTCCGAATT 60


9044R-1.IR_full       61  TACCTTGACGTTATCAGGTTCCCTGCTGCGTGCGCTAAACGACTCCTTCACCCTGATCGC 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9044R-1.in silico     61  TACCTTGACGTTATCAGGTTCCCTGCTGCGTGCGCTAAACGACTCCTTCACCCTGATCGC 120


9044R-1.IR_full       121 GGACACTGAAATCGGAACTGGCGCGGGTTACCTCCAGCCGCAGTCTTTTCAGGTGGTCAA 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9044R-1.in silico     121 GGACACTGAAATCGGAACTGGCGCGGGTTACCTCCAGCCGCAGTCTTTTCAGGTGGTCAA 180


9044R-1.IR_full       181 GCCCATCAACGCCAAGTCCAGCGTCTTCCCCGACCTCCAGCTGGTCCACGACTTTGTGCA 240
                          |||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||
9044R-1.in silico     181 GCCCATCAACGCCAAGTCCAGCGTCTTCCCCGACCTCCAGCTTGTCCATGACTTTGTGCA 240


9044R-1.IR_full       241 GAAAACGACGCTTTTGAAGCTGACCTACTTTCCCAGCGAACACTATTTCGAGGGCGCCAT 300
                          |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||
9044R-1.in silico     241 GAAAACGACGCTTTTGAAGCTGACCTACTTTCCCAGCGAACACTATTTTGAGGGCGCCAT 300


9044R-1.IR_full       301 CGACATAGCGAAGTTTCGAGCACTGCGCNCGCCTCGAGGTAAACAAAATCAACATCGGCC 360
                          |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||
9044R-1.in silico     301 CGACATAGCGAAGTTTCGAGCACTGCGC-CGCCTCGAGGTAAACAAAATCAACATCGGCC 360


9044R-1.IR_full       361 AAGTTGTGGGCATCCAACCGCTGCGCGGCCAGCTGCAACATTTGATCTGCGTAAAAAGCC 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9044R-1.in silico     361 AAGTTGTGGGCATCCAACCGCTGCGCGGCCAGCTGCAACATTTGATCTGCGTAAAAAGCC 420


9044R-1.IR_full       421 TTACCAGCGTGGACGACATTATCACGCGCTGCGGCGGCGACAACTCGAATGGCTTTGTGT 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9044R-1.in silico     421 TTACCAGCGTGGACGACATTATCACGCGCTGCGGCGGCGACAACTCGAATGGCTTTGTGT 480


9044R-1.IR_full       481 GGAACGAGCTAAANGACGGCCGA 503
                          ||||||||||||| |||||||||
9044R-1.in silico     481 GGAACGAGCTAAA-GACGGCCGA 503

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_135127.1  CG9044-RA (CG9044), mRNA 
0.2   NM_079459.2  CG5231-RA, transcript variant A (Las), mRNA 
0.2   NM_168855.1  CG5231-RB, transcript variant B (Las), mRNA 
0   NM_135077.2  CG14023-RA (CG14023), mRNA 
0   NM_142478.2  CG14303-RA (CG14303), mRNA 
0   NM_137801.2  CG6203-RA, transcript variant A (Fmr1), mRNA 
0   NM_169324.1  CG6203-RC, transcript variant C (Fmr1), mRNA 
0   NM_169327.1  CG6203-RB, transcript variant B (Fmr1), mRNA 
0   NM_131982.1  CG3323-RA (CG3323), mRNA 
0   NM_136337.2  CG17337-RA (CG17337), mRNA 
0   NM_001038743.1  CG33980-RA (CG33980), mRNA 
0   NM_143971.1  CG15922-RA (CG15922), mRNA 
0   NM_080535.2  CG9774-RA (rok), mRNA 
0   NM_001014610.1  CG33546-RB, transcript variant B (gfzf), mRNA 
0   NM_001031925.1  CG9130-RA, transcript variant A (CG9130), mRNA 
0   NM_001031923.1  CG9133-RC, transcript variant C (CG9133), mRNA 
0   NM_001031924.1  CG9130-RB, transcript variant B (CG9130), mRNA 
0   NM_001031921.1  CG9133-RD, transcript variant D (CG9133), mRNA 
0   NM_080339.2  CG10706-RE, transcript variant E (SK), mRNA 
0   NM_167030.1  CG10706-RD, transcript variant D (SK), mRNA 
0   NM_206241.1  CG1275-RD, transcript variant D (CG1275), mRNA 
0   NM_167942.1  CG1275-RA, transcript variant A (CG1275), mRNA 
0   NM_167941.1  CG1275-RC, transcript variant C (CG1275), mRNA 
0   NM_139446.2  CG1275-RB, transcript variant B (CG1275), mRNA 
0   NM_169258.1  CG9755-RA, transcript variant A (pum), mRNA 
0   NM_169259.1  CG9755-RD, transcript variant D (pum), mRNA 
0   NM_079561.2  CG9755-RC, transcript variant C (pum), mRNA 
0   NM_132719.2  CG32604-RA, transcript variant A (l(1)G0007), mRNA 
0   NM_176427.1  CG9755-RE, transcript variant E (pum), mRNA 
0   NM_169260.1  CG9755-RB, transcript variant B (pum), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.