National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock temporarily unavailable request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 9042R-1 
 Symbol Gpdh  Full Name Glycerol 3 phosphate dehydrogenase 
 CG No CG9042  Old CG No CG9042 
 Synonyms alpha-Gpdh, alpha-GPD, CG9042, alphaGpdh, GPDH, gpdh, DROGPDHA, GPDA, alpha-GPDH-1, alphaGPDH, alpha-GPDH, Gpd, alphaGpdh-1, sn-Gpdh, alphaGpd, GPD, GAPDH, Gdh, Gpdh 
 Accession No (Link to NCBI) NM_057219.3 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees male sex abnormal 
 Map Viewer
[Please submit your publication]
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| silico     1   GGGGTTCGGCCATAGCGAAAA-TCGTGGGCGCCAATGCCGCCGCTCTGCCGGAGTTCGAG 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  GAGCGTGTGACGATGTTCGTCTACGAGGAGCTCATCGATGGCAAGAAGCTGACGGAGATT 120

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 ATCAACGAGACGCACGAGAACGTCAAGTACCTGAAAGGACACAAGCTGCCCCCGAATGTG 180

                          | |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| silico     181 G-TTGCCGTGCCCGACCTGGTTGAGGCCGCCAAGAACGCTGACATCCTGATCTTCGTGGT 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 GCCCCACCAGTTCATTCCCAACTTCTGCAAACAGCTACTGGGCAAGATTAAGCCAAATGC 300

                          ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| silico     301 CATCGCTATCTCCCTGATCAAGGGCTTCGACAAGGCCGAGGGCGGCGGC-ATCGATCTGA 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 TCTCGCATATAATCACGCGTCACCTGAAGATCCCATGCGCCGTGTTGATGGGCGCAAACC 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 TGGCCAACGAGGTGGCTGAGGGCAACTTCTGCGAAACGACAATCGGCTGCACGGACAAGA 480

9042R-1.IR_full       481 AGTATGGCAAGGNGCTGCGCGAT 503
                          |||||||||||| |||||||||| silico     481 AGTATGGCAAGGTGCTGCGCGAT 503

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_057218.3  CG9042-RC, transcript variant C (Gpdh), mRNA 
100   482  NM_057217.3  CG9042-RB, transcript variant B (Gpdh), mRNA 
100   482  NM_057219.3  CG9042-RA, transcript variant A (Gpdh), mRNA 
0   NM_139562.1  CG14973-RA (CG14973), mRNA 
0   NM_078595.1  CG18319-RA (ben), mRNA 
0   NM_169672.1  CG4699-RB, transcript variant B (CG4699), mRNA 
0   NM_142235.1  CG4699-RA, transcript variant A (CG4699), mRNA 
0   NM_169673.1  CG4699-RC, transcript variant C (CG4699), mRNA 
0   NM_143100.1  CG11852-RA (CG11852), mRNA 
0   NM_132014.2  CG4119-RA (CG4119), mRNA 
0   NM_167628.1  CG6816-RA, transcript variant A (Cyp18a1), mRNA 
0   NM_078679.2  CG6816-RB, transcript variant B (Cyp18a1), mRNA 
0   NM_170213.2  CG31102-RA (CG31102), mRNA 
0   NM_079847.3  CG2184-RA, transcript variant A (Mlc2), mRNA 
0   NM_170474.2  CG2184-RB, transcript variant B (Mlc2), mRNA 
0   NM_078765.2  CG9115-RA (mtm), mRNA 
0   NM_080272.2  CG18816-RA, transcript variant A (Tsp42Eb), mRNA 
0   NM_142158.1  CG6966-RA (CG6966), mRNA 
0   NM_165503.1  CG18816-RB, transcript variant B (Tsp42Eb), mRNA 
0   NM_079521.2  CG1147-RA (NPFR1), mRNA 
0   NM_134964.1  CG3921-RA (CG3921), mRNA 
0   NM_132792.2  CG6227-RA (CG6227), mRNA 
0   NM_080522.2  CG9748-RA (bel), mRNA 
0   NM_168174.1  CG8398-RC, transcript variant C (CG8398), mRNA 
0   NM_168173.1  CG8398-RB, transcript variant B (CG8398), mRNA 
0   NM_139794.1  CG8398-RA, transcript variant A (CG8398), mRNA 
0   NM_206283.1  CG8398-RD, transcript variant D (CG8398), mRNA 
0   NM_080330.2  CG3620-RA, transcript variant A (norpA), mRNA 
0   NM_001014721.1  CG3620-RC, transcript variant C (norpA), mRNA 
0   NM_167008.1  CG3620-RB, transcript variant B (norpA), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.