National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 9042R-1 
 Symbol Gpdh  Full Name Glycerol 3 phosphate dehydrogenase 
 CG No CG9042  Old CG No CG9042 
 Synonyms alpha-Gpdh, alpha-GPD, CG9042, alphaGpdh, GPDH, gpdh, DROGPDHA, GPDA, alpha-GPDH-1, alphaGPDH, alpha-GPDH, Gpd, alphaGpdh-1, sn-Gpdh, alphaGpd, GPD, GAPDH, Gdh, Gpdh 
 Accession No (Link to NCBI) NM_057219.3 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees male sex abnormal 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGGGGTTCGGCCATAGCGAAAA 
 Primer Seq. 3'
aatctagaggtaccATCGCGCAGCACCTTGCCATA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GGGGTTCGGC CATAGCGAAA ATTCGTGGGC GCCAATGCCG CCGCTCTGCC GGAGTTCGAG 
0061 GAGCGTGTGA CGATGTTCGT CTACGAGGAG CTCATCGATG GCAAGAAGCT GACGGAGATT 
0121 ATCAACGAGA CGCACGAGAA CGTCAAGTAC CTGAAAGGAC ACAAGCTGCC CCCGAATGTG 
0181 GTTTGCCGTG CCCGNCCTGG TTGAGGCCGC CAAGAACGCT GACATCCTGA TCTTCGTGGT 
0241 GCCCCACCAG TTCATTCCCA ACTTCTGCAA ACAGCTACTG GGCAAGATTA AGCCAAATGC 
0301 CATCGCTATC TCCCTGATCA AGGGCTTCGA CAAGGCCGAG GGCGGCGGCN ATCGATCTGA 
0361 TCTCGCATAT AATCACGCGT CACCTGAAGA TCCCATGCGC CGTGTTGATG GGCGCAAACC 
0421 TGGCCAACGA GGTGGCTGAG GGCAACTTCT GCGAAACGAC AATCGGCTGC ACGGACAAGA 
0481 AGTATGGCAA GGNGCTGCGC GAT 
 in silico PCR Fragment
0001 GGGGTTCGGC CATAGCGAAA A-TCGTGGGC GCCAATGCCG CCGCTCTGCC GGAGTTCGAG 
0061 GAGCGTGTGA CGATGTTCGT CTACGAGGAG CTCATCGATG GCAAGAAGCT GACGGAGATT 
0121 ATCAACGAGA CGCACGAGAA CGTCAAGTAC CTGAAAGGAC ACAAGCTGCC CCCGAATGTG 
0181 G-TTGCCGTG CCCGACCTGG TTGAGGCCGC CAAGAACGCT GACATCCTGA TCTTCGTGGT 
0241 GCCCCACCAG TTCATTCCCA ACTTCTGCAA ACAGCTACTG GGCAAGATTA AGCCAAATGC 
0301 CATCGCTATC TCCCTGATCA AGGGCTTCGA CAAGGCCGAG GGCGGCGGC- ATCGATCTGA 
0361 TCTCGCATAT AATCACGCGT CACCTGAAGA TCCCATGCGC CGTGTTGATG GGCGCAAACC 
0421 TGGCCAACGA GGTGGCTGAG GGCAACTTCT GCGAAACGAC AATCGGCTGC ACGGACAAGA 
0481 AGTATGGCAA GGTGCTGCGC GAT 
 Assemble Data

9042R-1.IR_full       1   GGGGTTCGGCCATAGCGAAAATTCGTGGGCGCCAATGCCGCCGCTCTGCCGGAGTTCGAG 60
                          ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||
9042R-1.in silico     1   GGGGTTCGGCCATAGCGAAAA-TCGTGGGCGCCAATGCCGCCGCTCTGCCGGAGTTCGAG 60


9042R-1.IR_full       61  GAGCGTGTGACGATGTTCGTCTACGAGGAGCTCATCGATGGCAAGAAGCTGACGGAGATT 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9042R-1.in silico     61  GAGCGTGTGACGATGTTCGTCTACGAGGAGCTCATCGATGGCAAGAAGCTGACGGAGATT 120


9042R-1.IR_full       121 ATCAACGAGACGCACGAGAACGTCAAGTACCTGAAAGGACACAAGCTGCCCCCGAATGTG 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9042R-1.in silico     121 ATCAACGAGACGCACGAGAACGTCAAGTACCTGAAAGGACACAAGCTGCCCCCGAATGTG 180


9042R-1.IR_full       181 GTTTGCCGTGCCCGNCCTGGTTGAGGCCGCCAAGAACGCTGACATCCTGATCTTCGTGGT 240
                          | |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||
9042R-1.in silico     181 G-TTGCCGTGCCCGACCTGGTTGAGGCCGCCAAGAACGCTGACATCCTGATCTTCGTGGT 240


9042R-1.IR_full       241 GCCCCACCAGTTCATTCCCAACTTCTGCAAACAGCTACTGGGCAAGATTAAGCCAAATGC 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9042R-1.in silico     241 GCCCCACCAGTTCATTCCCAACTTCTGCAAACAGCTACTGGGCAAGATTAAGCCAAATGC 300


9042R-1.IR_full       301 CATCGCTATCTCCCTGATCAAGGGCTTCGACAAGGCCGAGGGCGGCGGCNATCGATCTGA 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||
9042R-1.in silico     301 CATCGCTATCTCCCTGATCAAGGGCTTCGACAAGGCCGAGGGCGGCGGC-ATCGATCTGA 360


9042R-1.IR_full       361 TCTCGCATATAATCACGCGTCACCTGAAGATCCCATGCGCCGTGTTGATGGGCGCAAACC 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9042R-1.in silico     361 TCTCGCATATAATCACGCGTCACCTGAAGATCCCATGCGCCGTGTTGATGGGCGCAAACC 420


9042R-1.IR_full       421 TGGCCAACGAGGTGGCTGAGGGCAACTTCTGCGAAACGACAATCGGCTGCACGGACAAGA 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9042R-1.in silico     421 TGGCCAACGAGGTGGCTGAGGGCAACTTCTGCGAAACGACAATCGGCTGCACGGACAAGA 480


9042R-1.IR_full       481 AGTATGGCAAGGNGCTGCGCGAT 503
                          |||||||||||| ||||||||||
9042R-1.in silico     481 AGTATGGCAAGGTGCTGCGCGAT 503

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_057218.3  CG9042-RC, transcript variant C (Gpdh), mRNA 
100   482  NM_057217.3  CG9042-RB, transcript variant B (Gpdh), mRNA 
100   482  NM_057219.3  CG9042-RA, transcript variant A (Gpdh), mRNA 
0   NM_139562.1  CG14973-RA (CG14973), mRNA 
0   NM_078595.1  CG18319-RA (ben), mRNA 
0   NM_169672.1  CG4699-RB, transcript variant B (CG4699), mRNA 
0   NM_142235.1  CG4699-RA, transcript variant A (CG4699), mRNA 
0   NM_169673.1  CG4699-RC, transcript variant C (CG4699), mRNA 
0   NM_143100.1  CG11852-RA (CG11852), mRNA 
0   NM_132014.2  CG4119-RA (CG4119), mRNA 
0   NM_167628.1  CG6816-RA, transcript variant A (Cyp18a1), mRNA 
0   NM_078679.2  CG6816-RB, transcript variant B (Cyp18a1), mRNA 
0   NM_170213.2  CG31102-RA (CG31102), mRNA 
0   NM_079847.3  CG2184-RA, transcript variant A (Mlc2), mRNA 
0   NM_170474.2  CG2184-RB, transcript variant B (Mlc2), mRNA 
0   NM_078765.2  CG9115-RA (mtm), mRNA 
0   NM_080272.2  CG18816-RA, transcript variant A (Tsp42Eb), mRNA 
0   NM_142158.1  CG6966-RA (CG6966), mRNA 
0   NM_165503.1  CG18816-RB, transcript variant B (Tsp42Eb), mRNA 
0   NM_079521.2  CG1147-RA (NPFR1), mRNA 
0   NM_134964.1  CG3921-RA (CG3921), mRNA 
0   NM_132792.2  CG6227-RA (CG6227), mRNA 
0   NM_080522.2  CG9748-RA (bel), mRNA 
0   NM_168174.1  CG8398-RC, transcript variant C (CG8398), mRNA 
0   NM_168173.1  CG8398-RB, transcript variant B (CG8398), mRNA 
0   NM_139794.1  CG8398-RA, transcript variant A (CG8398), mRNA 
0   NM_206283.1  CG8398-RD, transcript variant D (CG8398), mRNA 
0   NM_080330.2  CG3620-RA, transcript variant A (norpA), mRNA 
0   NM_001014721.1  CG3620-RC, transcript variant C (norpA), mRNA 
0   NM_167008.1  CG3620-RB, transcript variant B (norpA), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.