National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 9040R-2 
 Symbol CG9040  Full Name CG9040 
 CG No CG9040  Old CG No CG9040 
 Synonyms BcDNA:LP10528, CG9040 
 Accession No (Link to NCBI) NM_140420.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGAGGCTGCTGTTGGTTTTAAG 
 Primer Seq. 3'
aatctagaggtaccGCCTGTGCGTTTGCGTTTGTT 
 Predicted Fragment Size
481 
 IR fragment full Seq
0001 GAGGCTGCTG CTTGGCTTTT AAGCCTGGCC ATATCTGGTT GANCCTTCTG GAGGGTAACG 
0061 GGTGCTGATG ACACTGACGA TGACTATTAC GATTATTACG ACTATGGTGA TGACTACTAT 
0121 GACGACTCTG ATGTAGAGTC CAGTTCGGAA AGTGGTGTTG GTGCATCCAG TAGCTCAGAA 
0181 GAGTGATGCT AGTACCTCCG AGGACAGTTC CTCCGGCGAA GCTTCCGATA CAGGTAGTTC 
0241 TTCAGAAACT TCTGGAGATG GTTCCTCCGC CGAAACGACC TCCAGTTCAA CTCCAACCAA 
0301 GGCAGAAAAA GCCAAGAAAA CTGCTGCACG CAGAGCTANG ACGGCGCAGG CGCACCACCA 
0361 CCGCTGCTCC CAAACGCAAA GTACCGGCAG CCGCGTCTGC CAAGAAGCAA ACACCTGTTG 
0421 CCCAAAAGAA GAAGACACCT GTGGCAGCCA AGAAGAAGGC GAATACTGCC GCCAACAAAC 
0481 GCAAACGCAC ANGC 
 in silico PCR Fragment
0001 GAGGCTGCTG -TTGG-TTTT AAGCCTGGCC ATAT-TGGTT G--CCTTC-- ----GTAACG 
0061 GGTGCTGATG ACACTGACGA TGACTATTAC GATTATTACG ACTATGGTGA TGACTACTAT 
0121 GACGACTCTG ATGTAGAGTC CAGTTCGGAA AGTGGTGTTG GTGCATCCAG TAGCTCAGAA 
0181 GA-TGATGCT AGTACCTCCG AGGACAGTTC CTCCGGCGAA GCTTCCGATA CAGGTAGTTC 
0241 TTCAGAAACT TCTGGAGATG GTTCCTCCGC CGAAACGACC TCCAGTTCAA CTCCAACCAA 
0301 GGCAGAAAAA GCCAAGAAAA CTGCTGCACG CAGAGCTA-G ACGGCGCAGG CGCACCACCA 
0361 CCGCTGCTCC CAAACGCAAA GTAGCGGCAG CCGCGTCTGC CAAGAAGCAA ACACCTGTTG 
0421 CCCAAAAGAA GAAGACACCT GTGGCAGCCA AGAAGAAGGC GAATACTGCC GCCAACAAAC 
0481 GCAAACGCAC AGGC 
 Assemble Data

9040R-2.IR_full       1   GAGGCTGCTGCTTGGCTTTTAAGCCTGGCCATATCTGGTTGANCCTTCTGGAGGGTAACG 60
                          |||||||||| |||| |||||||||||||||||| ||||||  |||||      ||||||
9040R-2.in silico     1   GAGGCTGCTG-TTGG-TTTTAAGCCTGGCCATAT-TGGTTG--CCTTC------GTAACG 60


9040R-2.IR_full       61  GGTGCTGATGACACTGACGATGACTATTACGATTATTACGACTATGGTGATGACTACTAT 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9040R-2.in silico     61  GGTGCTGATGACACTGACGATGACTATTACGATTATTACGACTATGGTGATGACTACTAT 120


9040R-2.IR_full       121 GACGACTCTGATGTAGAGTCCAGTTCGGAAAGTGGTGTTGGTGCATCCAGTAGCTCAGAA 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9040R-2.in silico     121 GACGACTCTGATGTAGAGTCCAGTTCGGAAAGTGGTGTTGGTGCATCCAGTAGCTCAGAA 180


9040R-2.IR_full       181 GAGTGATGCTAGTACCTCCGAGGACAGTTCCTCCGGCGAAGCTTCCGATACAGGTAGTTC 240
                          || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9040R-2.in silico     181 GA-TGATGCTAGTACCTCCGAGGACAGTTCCTCCGGCGAAGCTTCCGATACAGGTAGTTC 240


9040R-2.IR_full       241 TTCAGAAACTTCTGGAGATGGTTCCTCCGCCGAAACGACCTCCAGTTCAACTCCAACCAA 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9040R-2.in silico     241 TTCAGAAACTTCTGGAGATGGTTCCTCCGCCGAAACGACCTCCAGTTCAACTCCAACCAA 300


9040R-2.IR_full       301 GGCAGAAAAAGCCAAGAAAACTGCTGCACGCAGAGCTANGACGGCGCAGGCGCACCACCA 360
                          |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
9040R-2.in silico     301 GGCAGAAAAAGCCAAGAAAACTGCTGCACGCAGAGCTA-GACGGCGCAGGCGCACCACCA 360


9040R-2.IR_full       361 CCGCTGCTCCCAAACGCAAAGTACCGGCAGCCGCGTCTGCCAAGAAGCAAACACCTGTTG 420
                          ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||
9040R-2.in silico     361 CCGCTGCTCCCAAACGCAAAGTAGCGGCAGCCGCGTCTGCCAAGAAGCAAACACCTGTTG 420


9040R-2.IR_full       421 CCCAAAAGAAGAAGACACCTGTGGCAGCCAAGAAGAAGGCGAATACTGCCGCCAACAAAC 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9040R-2.in silico     421 CCCAAAAGAAGAAGACACCTGTGGCAGCCAAGAAGAAGGCGAATACTGCCGCCAACAAAC 480


9040R-2.IR_full       481 GCAAACGCACANGC 494
                          ||||||||||| ||
9040R-2.in silico     481 GCAAACGCACAGGC 494

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   463  NM_140420.1  CG9040-RA (CG9040), mRNA 
0   NM_057579.3  CG12759-RA (Dbp45A), mRNA 
0   NM_176195.1  CG33017-RB (CG33017), mRNA 
0   10  NM_140419.1  CG17362-RA (CG17362), mRNA 
0   NM_137114.1  CG30070-RA (CG30070), mRNA 
0   NM_078771.2  CG11326-RA, transcript variant A (Tsp), mRNA 
0   NM_078516.2  CG12690-RA (CHES-1-like), mRNA 
0   NM_164719.1  CG32829-RA (CG32829), mRNA 
0   NM_205956.1  CG33302-RA (CG33302), mRNA 
0   NM_134527.1  CG15322-RA (CG15322), mRNA 
0   NM_141890.2  CG31358-RA (CG31358), mRNA 
0   NM_167231.3  CG17255-RB, transcript variant B (CG17255), mRNA 
0   NM_132403.3  CG17255-RA, transcript variant A (CG17255), mRNA 
0   NM_137318.2  CG5859-RA (CG5859), mRNA 
0   NM_164972.1  CG31757-RA (CG31757), mRNA 
0   NM_142121.1  CG7886-RA (CG7886), mRNA 
0   NM_135633.2  CG4636-RA (SCAR), mRNA 
0   NM_057837.3  CG1616-RA (dpa), mRNA 
0   NM_140156.1  CG6418-RB (CG6418), mRNA 
0   NM_079172.2  CG11494-RB, transcript variant B (BtbVII), mRNA 
0   NM_167990.1  CG11494-RA, transcript variant A (BtbVII), mRNA 
0   11  NM_136732.1  CG12904-RA (CG12904), mRNA 
0   NM_140448.1  CG9587-RA (CG9587), mRNA 
0   NM_176184.2  CG18250-RC, transcript variant C (Dg), mRNA 
0   NM_139488.2  CG1240-RA (CG1240), mRNA 
0   NM_168364.1  CG16707-RB, transcript variant B (vsg), mRNA 
0   NM_140092.1  CG16707-RC, transcript variant C (vsg), mRNA 
0   NM_168363.1  CG16707-RA, transcript variant A (vsg), mRNA 
0   NM_168362.1  CG16707-RD, transcript variant D (vsg), mRNA 
0   NM_134584.2  CG32512-RA (CG32512), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.