National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 9040R-1 
 Symbol CG9040  Full Name CG9040 
 CG No CG9040  Old CG No CG9040 
 Synonyms BcDNA:LP10528, CG9040 
 Accession No (Link to NCBI) NM_140420.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
[Please submit your publication]
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||| |||| |||||||||||||||||| ||||||  |||||      |||||| silico     1   GAGGCTGCTG-TTGG-TTTTAAGCCTGGCCATAT-TGGTTG--CCTTC------GTAACG 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  GGTGCTGATGACACTGACGATGACTATTACGATTATTACGACTATGGTGATGACTACTAT 120

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 GACGACTCTGATGTAGAGTCCAGTTCGGAAAGTGGTGTTGGTGCATCCAGTAGCTCAGAA 180

                          || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 GA-TGATGCTAGTACCTCCGAGGACAGTTCCTCCGGCGAAGCTTCCGATACAGGTAGTTC 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 TTCAGAAACTTCTGGAGATGGTTCCTCCGCCGAAACGACCTCCAGTTCAACTCCAACCAA 300

                          |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| silico     301 GGCAGAAAAAGCCAAGAAAACTGCTGCACGCAGAGCTA-GACGGCGCAGGCGCACCACCA 360

                          ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| silico     361 CCGCTGCTCCCAAACGCAAAGTAGCGGCAGCCGCGTCTGCCAAGAAGCAAACACCTGTTG 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 CCCAAAAGAAGAAGACACCTGTGGCAGCCAAGAAGAAGGCGAATACTGCCGCCAACAAAC 480

9040R-1.IR_full       481 GCAAACGCACANGC 494
                          ||||||||||| || silico     481 GCAAACGCACAGGC 494

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   463  NM_140420.1  CG9040-RA (CG9040), mRNA 
0   NM_057579.3  CG12759-RA (Dbp45A), mRNA 
0   NM_176195.1  CG33017-RB (CG33017), mRNA 
0   10  NM_140419.1  CG17362-RA (CG17362), mRNA 
0   NM_137114.1  CG30070-RA (CG30070), mRNA 
0   NM_078771.2  CG11326-RA, transcript variant A (Tsp), mRNA 
0   NM_078516.2  CG12690-RA (CHES-1-like), mRNA 
0   NM_164719.1  CG32829-RA (CG32829), mRNA 
0   NM_205956.1  CG33302-RA (CG33302), mRNA 
0   NM_134527.1  CG15322-RA (CG15322), mRNA 
0   NM_141890.2  CG31358-RA (CG31358), mRNA 
0   NM_167231.3  CG17255-RB, transcript variant B (CG17255), mRNA 
0   NM_132403.3  CG17255-RA, transcript variant A (CG17255), mRNA 
0   NM_137318.2  CG5859-RA (CG5859), mRNA 
0   NM_164972.1  CG31757-RA (CG31757), mRNA 
0   NM_142121.1  CG7886-RA (CG7886), mRNA 
0   NM_135633.2  CG4636-RA (SCAR), mRNA 
0   NM_057837.3  CG1616-RA (dpa), mRNA 
0   NM_140156.1  CG6418-RB (CG6418), mRNA 
0   NM_079172.2  CG11494-RB, transcript variant B (BtbVII), mRNA 
0   NM_167990.1  CG11494-RA, transcript variant A (BtbVII), mRNA 
0   11  NM_136732.1  CG12904-RA (CG12904), mRNA 
0   NM_140448.1  CG9587-RA (CG9587), mRNA 
0   NM_176184.2  CG18250-RC, transcript variant C (Dg), mRNA 
0   NM_139488.2  CG1240-RA (CG1240), mRNA 
0   NM_168364.1  CG16707-RB, transcript variant B (vsg), mRNA 
0   NM_140092.1  CG16707-RC, transcript variant C (vsg), mRNA 
0   NM_168363.1  CG16707-RA, transcript variant A (vsg), mRNA 
0   NM_168362.1  CG16707-RD, transcript variant D (vsg), mRNA 
0   NM_134584.2  CG32512-RA (CG32512), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.