National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 9021R-1 
 Symbol CG9021  Full Name CG9021 
 CG No CG9021  Old CG No CG9021 
 Synonyms CG9021 
 Accession No (Link to NCBI) NM_135123.2 
 Inserted Chr. lll 
 Insertional Mutation  semi-lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTGCCTGCTTTTGGTCGCAGGA 
 Primer Seq. 3'
aatctagaggtaccCTGGTGCTGCTTGGTGGCCTT 
 Predicted Fragment Size
498 
 IR fragment full Seq
0001 TGCCTGCTTT TGGTCGCAGG ACAATCGGTC GTGGANNCCC AGGAGCCCCA GGAGCTCTCC 
0061 GATAGCACCA CCACTTACAT TGTCGATGGC TTTCCAGATG AATCTCAAGA GCTACCCGGC 
0121 ATAGTTGCGG AGACCGATGA GGAGATTGAA ATGAATGCGC ACAAGATCAA CTGGCTGCCC 
0181 GTTTGGGAGG AGCAGGAGCA TGTACGATTC GCACGGGAAG TGACCGAAAA GCCAGTTGGC 
0241 ACCGCAGCCA CTGCCGAGAA CTCCACGCCC AAAGACACGT TGGATCTCGT CCTGCAGCCC 
0301 AAGGAGAACA AGGAGTGCCC CACCAATGCT GAGCGTGGAC TCACCAACCT CGTCCGCGTA 
0361 GCTCGCCCAC TTTTGCCTGC TGCCACACTG AAGAACATCC TGGCGAATGG CGTTGAGGAT 
0421 CCCCAGGTTC AAGAGTTGAT CAAGTTGCTC CGCAGCGATA ACTTCAAGAC GCAAGTGCAG 
0481 CTGCTGAAGG CCACCAAGCA GCACCAg 
 in silico PCR Fragment
0001 TGCCTGCTTT TGGTCGCAGG ACAATCGGTC GT-------- -GGAGCCCCA GGAGCTCTCC 
0061 GATAGCACCA CCACTTACAT TGTCGATGGC TTTCCAGATG AATCTCAAGA GCTACCCGGC 
0121 ATAGTTGCGG AGACCGATGA GGAGATTGAA ATGAATGCGC ACAAGATCAA CTGGCTGCCC 
0181 GTTTGGGAGG AGCAGGAGCA TGTACGATTC GCACGGGAAG TGACCGAAAA GCCAGTTGGC 
0241 ACCGCAGCCA CTGCCGAGAA CTCCACGCCC AAAGACACGT TGGATCTCGT CCTGCAGCCC 
0301 AAGGAGAACA AGGAGTGCCC CACCAATGCT GAGCGTGGAC TCACCAACCT CGTCCGCGTA 
0361 GCTCGCCCAC TTTTGCCTGC TGCCACACTG AAGAACATCC TGGCGAATGG CGTTGAGGAT 
0421 CCCCAGGTTC AAGAGTTGAT CAAGTTGCTC CGCAGCGATA ACTTCAAAAC GCAAGTGCAG 
0481 CTGCTGAAGG CCACCAAGCA GCACCAG 
 Assemble Data

9021R-1.IR_full       1   TGCCTGCTTTTGGTCGCAGGACAATCGGTCGTGGANNCCCAGGAGCCCCAGGAGCTCTCC 60
                          ||||||||||||||||||||||||||||||||         |||||||||||||||||||
9021R-1.in silico     1   TGCCTGCTTTTGGTCGCAGGACAATCGGTCGT---------GGAGCCCCAGGAGCTCTCC 60


9021R-1.IR_full       61  GATAGCACCACCACTTACATTGTCGATGGCTTTCCAGATGAATCTCAAGAGCTACCCGGC 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9021R-1.in silico     61  GATAGCACCACCACTTACATTGTCGATGGCTTTCCAGATGAATCTCAAGAGCTACCCGGC 120


9021R-1.IR_full       121 ATAGTTGCGGAGACCGATGAGGAGATTGAAATGAATGCGCACAAGATCAACTGGCTGCCC 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9021R-1.in silico     121 ATAGTTGCGGAGACCGATGAGGAGATTGAAATGAATGCGCACAAGATCAACTGGCTGCCC 180


9021R-1.IR_full       181 GTTTGGGAGGAGCAGGAGCATGTACGATTCGCACGGGAAGTGACCGAAAAGCCAGTTGGC 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9021R-1.in silico     181 GTTTGGGAGGAGCAGGAGCATGTACGATTCGCACGGGAAGTGACCGAAAAGCCAGTTGGC 240


9021R-1.IR_full       241 ACCGCAGCCACTGCCGAGAACTCCACGCCCAAAGACACGTTGGATCTCGTCCTGCAGCCC 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9021R-1.in silico     241 ACCGCAGCCACTGCCGAGAACTCCACGCCCAAAGACACGTTGGATCTCGTCCTGCAGCCC 300


9021R-1.IR_full       301 AAGGAGAACAAGGAGTGCCCCACCAATGCTGAGCGTGGACTCACCAACCTCGTCCGCGTA 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9021R-1.in silico     301 AAGGAGAACAAGGAGTGCCCCACCAATGCTGAGCGTGGACTCACCAACCTCGTCCGCGTA 360


9021R-1.IR_full       361 GCTCGCCCACTTTTGCCTGCTGCCACACTGAAGAACATCCTGGCGAATGGCGTTGAGGAT 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9021R-1.in silico     361 GCTCGCCCACTTTTGCCTGCTGCCACACTGAAGAACATCCTGGCGAATGGCGTTGAGGAT 420


9021R-1.IR_full       421 CCCCAGGTTCAAGAGTTGATCAAGTTGCTCCGCAGCGATAACTTCAAGACGCAAGTGCAG 480
                          ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||
9021R-1.in silico     421 CCCCAGGTTCAAGAGTTGATCAAGTTGCTCCGCAGCGATAACTTCAAAACGCAAGTGCAG 480


9021R-1.IR_full       481 CTGCTGAAGGCCACCAAGCAGCACCAG 507
                          |||||||||||||||||||||||||||
9021R-1.in silico     481 CTGCTGAAGGCCACCAAGCAGCACCAG 507

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   480  NM_135123.2  CG9021-RA (CG9021), mRNA 
0   NM_167239.2  CG32677-RA (CG32677), mRNA 
0   NM_141712.2  CG3909-RA (CG3909), mRNA 
0   NM_142882.1  CG17083-RA (CG17083), mRNA 
0   NM_143616.3  CG1635-RA (CG1635), mRNA 
0   NM_135124.1  CG14001-RA (bchs), mRNA 
0   NM_134763.1  CG14351-RA (CG14351), mRNA 
0   NM_079172.2  CG11494-RB, transcript variant B (BtbVII), mRNA 
0   NM_167990.1  CG11494-RA, transcript variant A (BtbVII), mRNA 
0   NM_137426.2  CG5033-RA, transcript variant A (CG5033), mRNA 
0   NM_166248.1  CG5033-RB, transcript variant B (CG5033), mRNA 
0   NM_167640.1  CG7990-RB, transcript variant B (CG7990), mRNA 
0   NM_133133.1  CG7990-RA, transcript variant A (CG7990), mRNA 
0   NM_135839.2  CG7953-RA (CG7953), mRNA 
0   NM_133087.1  CG6617-RA (CG6617), mRNA 
0   NM_139595.2  CG1135-RA (CG1135), mRNA 
0   NM_166864.1  CG14632-RA, transcript variant A (CG14632), mRNA 
0   NM_130511.1  CG14632-RB, transcript variant B (CG14632), mRNA 
0   NM_206524.1  CG17269-RA (Fancd2), mRNA 
0   NM_142821.2  CG17625-RA (CG17625), mRNA 
0   NM_001043095.1  CG15078-RB, transcript variant B (Mctp), mRNA 
0   NM_137528.3  CG15078-RA, transcript variant A (Mctp), mRNA 
0   NM_001043094.1  CG15078-RC, transcript variant C (Mctp), mRNA 
0   17  NM_001031867.1  CG33950-RF, transcript variant F (trol), mRNA 
0   14  NM_001031862.1  CG33950-RC, transcript variant C (trol), mRNA 
0   14  NM_001031864.1  CG33950-RE, transcript variant E (trol), mRNA 
0   14  NM_001031866.1  CG33950-RA, transcript variant A (trol), mRNA 
0   14  NM_001031863.1  CG33950-RD, transcript variant D (trol), mRNA 
0   13  NM_001031865.1  CG33950-RB, transcript variant B (trol), mRNA 
0   NM_133073.2  CG6394-RA, transcript variant A (GalNAc-T2), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.