National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 9005R-2 
 Symbol CG9005  Full Name CG9005 
 CG No CG9005  Old CG No CG9005 
 Synonyms BcDNA:GH05710, CG9005 
 Accession No (Link to NCBI) NM_136844.3 
 Inserted Chr. ll 
 Insertional Mutation  semi-lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATGATACCGACAAGCGTCACC 
 Primer Seq. 3'
aatctagaggtaccTCTGGGCAGCCGGCGAAATCT 
 Predicted Fragment Size
496 
 IR fragment full Seq
0001 ATGATACCGA CAAGCGTCAC CAACTCACCG CCGCCAGCGG GTTTGGGCCA GAATGGAGCA 
0061 TCTGCCTCCT TGGGCTCGGC TACTGCGGCG GCCGGAGGAG GNATGCTGTC CGGCTTGGGA 
0121 ATGGTGGCGG TCTCTGGATG TGGGTCGGCA GGAACAGGAG CTCAGAATAA CTACGGTTCC 
0181 GTTGTGCTCG GCTTGGCCTC GCTAATCCTC GAGGGCAGAC CCATTGCCGA CGATGAGTAC 
0241 CAGCAGCAGA CGGTGGGAGT AGTCGGTTCA GGAGCAGCAA CAGCAGGATC TGGGGGAGGA 
0301 CNNCTATCGC CACGACCCTC CACCTCCAGG GCGGCCATTA ACATCACAAC GAATCCCTAT 
0361 GGTTCCATGG GAGGATCGGA AAATAGAGCC GTCAATGGAA GTGGTTCGAC TGGGTCGCCC 
0421 AGCAGTAGTT CGCTAACCCA CCAGCGATGG ACACAGAAgC TCTGCCAGCT GCGTCAGATT 
0481 TCGCCGGCTG CCCAGA 
 in silico PCR Fragment
0001 ATGATACCGA CAAGCGTCAC CAACTCACCG CCGCCAGCGG GTTTGGGCCA GAATGGAGCA 
0061 TCTGCCTCCT TGGGCTCGGC TACTGCGGCG GCCGGAGGAG GGATGCTGTC CGGCTTGGGA 
0121 ATGGTGGCGG TCTCTGGATG TGGGTCGGCA GGAACAGGAG CTCAGAATAA CTACGGTTCC 
0181 GTTGTGCTCG GCTTGGCCTC GCTAATCCTC GAGGGCAGAC CCATTGCCGA CGATGAGTAC 
0241 CAGCAGCAGA CGGTGGGAGT AGTCGGTTCA GGAGCAGCAA CAGCAGGATC TGGGGGAGGA 
0301 CGCCTATCGC CACGACCCTC CACCTCCAGG GCGGCCATTA ACATCACAAC GAATCCCTAT 
0361 GGTTCCATGG GAGGATCGGA AAATAGAGCC GTCAATGGAA GTGGTTCGAC TGGGTCGCCC 
0421 AGCAGTAGTT CGCTAACCCA CCAGCGATGG ACACAGAAGC TCTGCCAGCT GCGTCAGATT 
0481 TCGCCGGCTG CCCAGA 
 Assemble Data

9005R-2.IR_full       1   ATGATACCGACAAGCGTCACCAACTCACCGCCGCCAGCGGGTTTGGGCCAGAATGGAGCA 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9005R-2.in silico     1   ATGATACCGACAAGCGTCACCAACTCACCGCCGCCAGCGGGTTTGGGCCAGAATGGAGCA 60


9005R-2.IR_full       61  TCTGCCTCCTTGGGCTCGGCTACTGCGGCGGCCGGAGGAGGNATGCTGTCCGGCTTGGGA 120
                          ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||
9005R-2.in silico     61  TCTGCCTCCTTGGGCTCGGCTACTGCGGCGGCCGGAGGAGGGATGCTGTCCGGCTTGGGA 120


9005R-2.IR_full       121 ATGGTGGCGGTCTCTGGATGTGGGTCGGCAGGAACAGGAGCTCAGAATAACTACGGTTCC 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9005R-2.in silico     121 ATGGTGGCGGTCTCTGGATGTGGGTCGGCAGGAACAGGAGCTCAGAATAACTACGGTTCC 180


9005R-2.IR_full       181 GTTGTGCTCGGCTTGGCCTCGCTAATCCTCGAGGGCAGACCCATTGCCGACGATGAGTAC 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9005R-2.in silico     181 GTTGTGCTCGGCTTGGCCTCGCTAATCCTCGAGGGCAGACCCATTGCCGACGATGAGTAC 240


9005R-2.IR_full       241 CAGCAGCAGACGGTGGGAGTAGTCGGTTCAGGAGCAGCAACAGCAGGATCTGGGGGAGGA 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9005R-2.in silico     241 CAGCAGCAGACGGTGGGAGTAGTCGGTTCAGGAGCAGCAACAGCAGGATCTGGGGGAGGA 300


9005R-2.IR_full       301 CNNCTATCGCCACGACCCTCCACCTCCAGGGCGGCCATTAACATCACAACGAATCCCTAT 360
                          |  |||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9005R-2.in silico     301 CGCCTATCGCCACGACCCTCCACCTCCAGGGCGGCCATTAACATCACAACGAATCCCTAT 360


9005R-2.IR_full       361 GGTTCCATGGGAGGATCGGAAAATAGAGCCGTCAATGGAAGTGGTTCGACTGGGTCGCCC 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9005R-2.in silico     361 GGTTCCATGGGAGGATCGGAAAATAGAGCCGTCAATGGAAGTGGTTCGACTGGGTCGCCC 420


9005R-2.IR_full       421 AGCAGTAGTTCGCTAACCCACCAGCGATGGACACAGAAGCTCTGCCAGCTGCGTCAGATT 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9005R-2.in silico     421 AGCAGTAGTTCGCTAACCCACCAGCGATGGACACAGAAGCTCTGCCAGCTGCGTCAGATT 480


9005R-2.IR_full       481 TCGCCGGCTGCCCAGA 496
                          ||||||||||||||||
9005R-2.in silico     481 TCGCCGGCTGCCCAGA 496

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   478  NM_136844.3  CG9005-RA (CG9005), mRNA 
0.2   NM_166047.1  CG8603-RB, transcript variant B (CG8603), mRNA 
0.2   NM_137108.2  CG8603-RA, transcript variant A (CG8603), mRNA 
0   10  NM_080325.3  CG6450-RC (lva), mRNA 
0   13  47  NM_132525.1  CG15740-RA (CG15740), mRNA 
0   15  NM_167990.1  CG11494-RA, transcript variant A (BtbVII), mRNA 
0   15  NM_079172.2  CG11494-RB, transcript variant B (BtbVII), mRNA 
0   19  NM_169816.1  CG14307-RB, transcript variant B (fru), mRNA 
0   19  NM_079673.2  CG14307-RF, transcript variant F (fru), mRNA 
0   11  NM_078549.3  CG32688-RA, transcript variant A (Hk), mRNA 
0   11  NM_167222.1  CG32688-RB, transcript variant B (Hk), mRNA 
0   NM_130677.1  CG14418-RA (CG14418), mRNA 
0   NM_142942.3  CG31140-RA, transcript variant A (CG31140), mRNA 
0   NM_206553.1  CG31140-RB, transcript variant B (CG31140), mRNA 
0   NM_206552.1  CG31140-RC, transcript variant C (CG31140), mRNA 
0   17  55  NM_167231.3  CG17255-RB, transcript variant B (CG17255), mRNA 
0   17  55  NM_132403.3  CG17255-RA, transcript variant A (CG17255), mRNA 
0   38  NM_206091.1  CG7734-RD, transcript variant D (shn), mRNA 
0   38  NM_057375.3  CG7734-RA, transcript variant A (shn), mRNA 
0   38  NM_134279.2  CG7734-RB, transcript variant B (shn), mRNA 
0   38  NM_057376.2  CG7734-RC, transcript variant C (shn), mRNA 
0   37  NM_176556.1  CG33106-RA, transcript variant A (mask), mRNA 
0   37  NM_176557.1  CG33106-RB, transcript variant B (mask), mRNA 
0   11  NM_132093.2  CG3367-RA (CG3367), mRNA 
0   NM_139705.1  CG10633-RA (CG10633), mRNA 
0   NM_142592.1  CG4462-RA (CG4462), mRNA 
0   10  NM_057685.3  CG11527-RA (Tig), mRNA 
0   NM_169843.1  CG31222-RA (CG31222), mRNA 
0   NM_001014673.1  CG6354-RG, transcript variant G (Rb97D), mRNA 
0   NM_079796.3  CG6354-RB, transcript variant B (Rb97D), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.