National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 9005R-1 
 Symbol CG9005  Full Name CG9005 
 CG No CG9005  Old CG No CG9005 
 Synonyms BcDNA:GH05710, CG9005 
 Accession No (Link to NCBI) NM_136844.3 
 Inserted Chr. ll 
 Insertional Mutation  lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees male lethal 
 Map Viewer
[Please submit your publication]
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   ATGATACCGACAAGCGTCACCAACTCACCGCCGCCAGCGGGTTTGGGCCAGAATGGAGCA 60

                          ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| silico     61  TCTGCCTCCTTGGGCTCGGCTACTGCGGCGGCCGGAGGAGGGATGCTGTCCGGCTTGGGA 120

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 ATGGTGGCGGTCTCTGGATGTGGGTCGGCAGGAACAGGAGCTCAGAATAACTACGGTTCC 180

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 GTTGTGCTCGGCTTGGCCTCGCTAATCCTCGAGGGCAGACCCATTGCCGACGATGAGTAC 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 CAGCAGCAGACGGTGGGAGTAGTCGGTTCAGGAGCAGCAACAGCAGGATCTGGGGGAGGA 300

                          |  ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 CGCCTATCGCCACGACCCTCCACCTCCAGGGCGGCCATTAACATCACAACGAATCCCTAT 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 GGTTCCATGGGAGGATCGGAAAATAGAGCCGTCAATGGAAGTGGTTCGACTGGGTCGCCC 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 AGCAGTAGTTCGCTAACCCACCAGCGATGGACACAGAAGCTCTGCCAGCTGCGTCAGATT 480

9005R-1.IR_full       481 TCGCCGGCTGCCCAGA 496
                          |||||||||||||||| silico     481 TCGCCGGCTGCCCAGA 496

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   478  NM_136844.3  CG9005-RA (CG9005), mRNA 
0.2   NM_166047.1  CG8603-RB, transcript variant B (CG8603), mRNA 
0.2   NM_137108.2  CG8603-RA, transcript variant A (CG8603), mRNA 
0   10  NM_080325.3  CG6450-RC (lva), mRNA 
0   13  47  NM_132525.1  CG15740-RA (CG15740), mRNA 
0   15  NM_167990.1  CG11494-RA, transcript variant A (BtbVII), mRNA 
0   15  NM_079172.2  CG11494-RB, transcript variant B (BtbVII), mRNA 
0   19  NM_169816.1  CG14307-RB, transcript variant B (fru), mRNA 
0   19  NM_079673.2  CG14307-RF, transcript variant F (fru), mRNA 
0   11  NM_078549.3  CG32688-RA, transcript variant A (Hk), mRNA 
0   11  NM_167222.1  CG32688-RB, transcript variant B (Hk), mRNA 
0   NM_130677.1  CG14418-RA (CG14418), mRNA 
0   NM_142942.3  CG31140-RA, transcript variant A (CG31140), mRNA 
0   NM_206553.1  CG31140-RB, transcript variant B (CG31140), mRNA 
0   NM_206552.1  CG31140-RC, transcript variant C (CG31140), mRNA 
0   17  55  NM_167231.3  CG17255-RB, transcript variant B (CG17255), mRNA 
0   17  55  NM_132403.3  CG17255-RA, transcript variant A (CG17255), mRNA 
0   38  NM_206091.1  CG7734-RD, transcript variant D (shn), mRNA 
0   38  NM_057375.3  CG7734-RA, transcript variant A (shn), mRNA 
0   38  NM_134279.2  CG7734-RB, transcript variant B (shn), mRNA 
0   38  NM_057376.2  CG7734-RC, transcript variant C (shn), mRNA 
0   37  NM_176556.1  CG33106-RA, transcript variant A (mask), mRNA 
0   37  NM_176557.1  CG33106-RB, transcript variant B (mask), mRNA 
0   11  NM_132093.2  CG3367-RA (CG3367), mRNA 
0   NM_139705.1  CG10633-RA (CG10633), mRNA 
0   NM_142592.1  CG4462-RA (CG4462), mRNA 
0   10  NM_057685.3  CG11527-RA (Tig), mRNA 
0   NM_169843.1  CG31222-RA (CG31222), mRNA 
0   NM_001014673.1  CG6354-RG, transcript variant G (Rb97D), mRNA 
0   NM_079796.3  CG6354-RB, transcript variant B (Rb97D), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.