National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 8982R-2 
 Symbol Acp26Aa  Full Name Accessory gland-specific peptide 26Aa 
 CG No CG8982  Old CG No CG8982 
 Synonyms Acp26A, Ovulin, Acp26Aab, Mst26Aa, Mst26A, mst 355a, mst355a, msP355a, CG8982, Acp26Aa 
 Accession No (Link to NCBI) NM_057296.2 
 Inserted Chr. ll 
 Insertional Mutation  lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
[Please submit your publication]
Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS One (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   GCAAGCTGCGATAGTGAGCAACAACTCGATTCAGCTATGCACCTGAAAAGTGATTCTACG 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  AAAAGTGCATCTCTGAAAAATGTTGCTCCCAAGAATGATGAGACACAGGCCAAAATAGCC 120

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 AAAGATGATGTAGCTCTGAAAGATGCGAAAAAGGGCGATTATATAATGGATATCGATATT 180

                          ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| silico     181 TCTGATTTGCCGCTGGATGATTATCCAATCAATAGGTCCAAATCACTAAAAAGCTCTTCC 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 ATTGACTTGAATAATATTCCTTTCAATAAAGGACTAGATGATTTCCCGGCAAAAGAAAAA 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 AATCAAGGATCCAATCAAAGTGCGCTCAAGGCCCTGCAACAGAGGTTACTAACGGAGCAG 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 AACAATAGTTTACTTCTCCGGAACCATTCCATATACTTGATGAAAGAAATAGAGGCCAGA 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 AAAACGGATATTATCAAAGTACGACAGTTAAACCTCGATTTAGAGCTCGAGCTAAATACT 480

8982R-2.IR_full       481 GTGAACCGCAGACTTTTGGA 500
                          |||||||||||||||||||| silico     481 GTGAACCGCAGACTTTTGGA 500

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_057296.2  CG8982-RA (Acp26Aa), mRNA 
0   NM_143575.2  CG12071-RA, transcript variant A (CG12071), mRNA 
0   NM_176592.1  CG12071-RB, transcript variant B (CG12071), mRNA 
0   NM_140549.2  CG12713-RA (CG12713), mRNA 
0   NM_142057.2  CG9307-RA (CG9307), mRNA 
0   NM_166151.2  CG8433-RA, transcript variant A (Ext2), mRNA 
0   NM_001032251.1  CG10731-RA, transcript variant A (CG10731), mRNA 
0   NM_166150.2  CG8433-RB, transcript variant B (Ext2), mRNA 
0   NM_144448.2  CG1915-RC, transcript variant C (sls), mRNA 
0   NM_057376.2  CG7734-RC, transcript variant C (shn), mRNA 
0   NM_169959.2  CG31438-RA (CheB93b), mRNA 
0   NM_134279.2  CG7734-RB, transcript variant B (shn), mRNA 
0   NM_057375.3  CG7734-RA, transcript variant A (shn), mRNA 
0   NM_206091.1  CG7734-RD, transcript variant D (shn), mRNA 
0   12  NM_132338.1  CG15316-RA, transcript variant A (CG15316), mRNA 
0   12  NM_140271.1  CG17826-RA (CG17826), mRNA 
0   12  NM_167190.1  CG15316-RB, transcript variant B (CG15316), mRNA 
0   NM_132193.1  CG1514-RA (CG1514), mRNA 
0   NM_139569.1  CG10858-RA (CG10858), mRNA 
0   NM_131968.2  CG32772-RA (CG32772), mRNA 
0   NM_168571.2  CG32133-RA (CG32133), mRNA 
0   NM_001015389.1  CG15848-PA.3 (CG15848), mRNA 
0   10  NM_137427.2  CG5036-RA (CG5036), mRNA 
0   NM_168854.1  CG5274-RB, transcript variant B (CG5274), mRNA 
0   NM_001032062.1  CG9515-RA, transcript variant A (CG9515), mRNA 
0   NM_135413.2  CG9510-RA, transcript variant A (CG9510), mRNA 
0   NM_001032063.1  CG9510-RB, transcript variant B (CG9510), mRNA 
0   NM_135348.2  CG8451-RA (CG8451), mRNA 
0   NM_078745.2  CG12676-RA (ed), mRNA 
0   NM_079937.2  CG1915-RA, transcript variant A (sls), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.