National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 8982R-1 
 Symbol Acp26Aa  Full Name Accessory gland-specific peptide 26Aa 
 CG No CG8982  Old CG No CG8982 
 Synonyms Acp26A, Ovulin, Acp26Aab, Mst26Aa, Mst26A, mst 355a, mst355a, msP355a, CG8982, Acp26Aa 
 Accession No (Link to NCBI) NM_057296.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS One (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGCAAGCTGCGATAGTGAGCAA 
 Primer Seq. 3'
aatctagaggtaccTCCAAAAGTCTGCGGTTCACA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GCAAGCTGCG ATAGTGAGCA ACAACTCGAT TCAGCTATGC ACCTGAAAAG TGATTCTACG 
0061 AAAAGTGCAT CTCTGAAAAA TGTTGCTCCC AAGAATGATG AGACACAGGC CAAAATAGCC 
0121 AAAGATGATG TAGCTCTGAA AGATGCGAAA AAGGGCGATT ATATAATGGA TATCGATATT 
0181 TCTGATTTGC CGCTGGATGA TTATCCAATC AATAGGTCCA AATCACTAAA AAGNTCTTCC 
0241 ATTGACTTGA ATAATATTCC TTTCAATAAA GGACTAGATG ATTTCCCGGC AAAAGAAAAA 
0301 AATCAAGGAT CCAATCAAAG TGCGCTCAAG GCCCTGCAAC AGAGGTTACT AACGGAGCAG 
0361 AACAATAGTT TACTTCTCCG GAACCATTCC ATATACTTGA TGAAAGAAAT AGAGGCCAGA 
0421 AAAACGGATA TTATCAAAGT ACGACAGTTA AACCTCGATT TAGAGCTCGA GCTAAATACT 
0481 GTGAACCGCA GACTTTTGGA  
 in silico PCR Fragment
0001 GCAAGCTGCG ATAGTGAGCA ACAACTCGAT TCAGCTATGC ACCTGAAAAG TGATTCTACG 
0061 AAAAGTGCAT CTCTGAAAAA TGTTGCTCCC AAGAATGATG AGACACAGGC CAAAATAGCC 
0121 AAAGATGATG TAGCTCTGAA AGATGCGAAA AAGGGCGATT ATATAATGGA TATCGATATT 
0181 TCTGATTTGC CGCTGGATGA TTATCCAATC AATAGGTCCA AATCACTAAA AAGCTCTTCC 
0241 ATTGACTTGA ATAATATTCC TTTCAATAAA GGACTAGATG ATTTCCCGGC AAAAGAAAAA 
0301 AATCAAGGAT CCAATCAAAG TGCGCTCAAG GCCCTGCAAC AGAGGTTACT AACGGAGCAG 
0361 AACAATAGTT TACTTCTCCG GAACCATTCC ATATACTTGA TGAAAGAAAT AGAGGCCAGA 
0421 AAAACGGATA TTATCAAAGT ACGACAGTTA AACCTCGATT TAGAGCTCGA GCTAAATACT 
0481 GTGAACCGCA GACTTTTGGA  
 Assemble Data

8982R-1.IR_full       1   GCAAGCTGCGATAGTGAGCAACAACTCGATTCAGCTATGCACCTGAAAAGTGATTCTACG 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8982R-1.in silico     1   GCAAGCTGCGATAGTGAGCAACAACTCGATTCAGCTATGCACCTGAAAAGTGATTCTACG 60


8982R-1.IR_full       61  AAAAGTGCATCTCTGAAAAATGTTGCTCCCAAGAATGATGAGACACAGGCCAAAATAGCC 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8982R-1.in silico     61  AAAAGTGCATCTCTGAAAAATGTTGCTCCCAAGAATGATGAGACACAGGCCAAAATAGCC 120


8982R-1.IR_full       121 AAAGATGATGTAGCTCTGAAAGATGCGAAAAAGGGCGATTATATAATGGATATCGATATT 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8982R-1.in silico     121 AAAGATGATGTAGCTCTGAAAGATGCGAAAAAGGGCGATTATATAATGGATATCGATATT 180


8982R-1.IR_full       181 TCTGATTTGCCGCTGGATGATTATCCAATCAATAGGTCCAAATCACTAAAAAGNTCTTCC 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||
8982R-1.in silico     181 TCTGATTTGCCGCTGGATGATTATCCAATCAATAGGTCCAAATCACTAAAAAGCTCTTCC 240


8982R-1.IR_full       241 ATTGACTTGAATAATATTCCTTTCAATAAAGGACTAGATGATTTCCCGGCAAAAGAAAAA 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8982R-1.in silico     241 ATTGACTTGAATAATATTCCTTTCAATAAAGGACTAGATGATTTCCCGGCAAAAGAAAAA 300


8982R-1.IR_full       301 AATCAAGGATCCAATCAAAGTGCGCTCAAGGCCCTGCAACAGAGGTTACTAACGGAGCAG 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8982R-1.in silico     301 AATCAAGGATCCAATCAAAGTGCGCTCAAGGCCCTGCAACAGAGGTTACTAACGGAGCAG 360


8982R-1.IR_full       361 AACAATAGTTTACTTCTCCGGAACCATTCCATATACTTGATGAAAGAAATAGAGGCCAGA 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8982R-1.in silico     361 AACAATAGTTTACTTCTCCGGAACCATTCCATATACTTGATGAAAGAAATAGAGGCCAGA 420


8982R-1.IR_full       421 AAAACGGATATTATCAAAGTACGACAGTTAAACCTCGATTTAGAGCTCGAGCTAAATACT 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8982R-1.in silico     421 AAAACGGATATTATCAAAGTACGACAGTTAAACCTCGATTTAGAGCTCGAGCTAAATACT 480


8982R-1.IR_full       481 GTGAACCGCAGACTTTTGGA 500
                          ||||||||||||||||||||
8982R-1.in silico     481 GTGAACCGCAGACTTTTGGA 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_057296.2  CG8982-RA (Acp26Aa), mRNA 
0   NM_143575.2  CG12071-RA, transcript variant A (CG12071), mRNA 
0   NM_176592.1  CG12071-RB, transcript variant B (CG12071), mRNA 
0   NM_140549.2  CG12713-RA (CG12713), mRNA 
0   NM_142057.2  CG9307-RA (CG9307), mRNA 
0   NM_166151.2  CG8433-RA, transcript variant A (Ext2), mRNA 
0   NM_001032251.1  CG10731-RA, transcript variant A (CG10731), mRNA 
0   NM_166150.2  CG8433-RB, transcript variant B (Ext2), mRNA 
0   NM_144448.2  CG1915-RC, transcript variant C (sls), mRNA 
0   NM_057376.2  CG7734-RC, transcript variant C (shn), mRNA 
0   NM_169959.2  CG31438-RA (CheB93b), mRNA 
0   NM_134279.2  CG7734-RB, transcript variant B (shn), mRNA 
0   NM_057375.3  CG7734-RA, transcript variant A (shn), mRNA 
0   NM_206091.1  CG7734-RD, transcript variant D (shn), mRNA 
0   12  NM_132338.1  CG15316-RA, transcript variant A (CG15316), mRNA 
0   12  NM_140271.1  CG17826-RA (CG17826), mRNA 
0   12  NM_167190.1  CG15316-RB, transcript variant B (CG15316), mRNA 
0   NM_132193.1  CG1514-RA (CG1514), mRNA 
0   NM_139569.1  CG10858-RA (CG10858), mRNA 
0   NM_131968.2  CG32772-RA (CG32772), mRNA 
0   NM_168571.2  CG32133-RA (CG32133), mRNA 
0   NM_001015389.1  CG15848-PA.3 (CG15848), mRNA 
0   10  NM_137427.2  CG5036-RA (CG5036), mRNA 
0   NM_168854.1  CG5274-RB, transcript variant B (CG5274), mRNA 
0   NM_001032062.1  CG9515-RA, transcript variant A (CG9515), mRNA 
0   NM_135413.2  CG9510-RA, transcript variant A (CG9510), mRNA 
0   NM_001032063.1  CG9510-RB, transcript variant B (CG9510), mRNA 
0   NM_135348.2  CG8451-RA (CG8451), mRNA 
0   NM_078745.2  CG12676-RA (ed), mRNA 
0   NM_079937.2  CG1915-RA, transcript variant A (sls), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.