National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 8947R-2 
 Symbol 26-29-p  Full Name 26-29kD-proteinase 
 CG No CG8947  Old CG No CG8947 
 Synonyms 26/29kD-proteinase, l(3)s3635, CG8947, 26-29-p 
 Accession No (Link to NCBI) NM_138985.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCCTGCTCGCAGGCTTGGCTTT 
 Primer Seq. 3'
aatctagaggtaccTCATCTCGTAGCGCACGGGAA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CCTGCTCGCA GGCTTGGCTT TCTCAGCTAA TGCCACGAAT CCGCCGAAAT GGGATCCAAA 
0061 CTACATAGTC AAAGGAACCC TGTACATTCC GTACGCCGAG ATTGCGGAAC CCTTCTACGC 
0121 CTGGTATGAC AAGAATACGA GGCGATCCCG CATCGATTAC TACGGCGGAA TGGTGAAGAC 
0181 ATACCAACTG GCTGGCGAGG GTCAGTACGG AACCCTGCTG AAGCTGGCAC CGATTACCAC 
0241 CAAGACGGAG AACAACAAGC TAACCTGTCT GCAGGTGAAT GGCACCGCCG ACCAGGCTGT 
0301 CGATATTCAG AGCATCCTGC CCGATGCGAA ACCTTTNCAG CCTGGTGGGC ACCGAATCCT 
0361 TTTTGGGCTA CACGTGCGAC AAGTTCCGCC TGGAGTCGAC AATTGGCCAA AAGAAGAACA 
0421 TCTATACGCT GTGGGTGCGG TACAAGAAGT CGCCGCATTA TCCCTCCAGC CGAATGCCCA 
0481 TTCCCGTGCG CTACGAGATG A 
 in silico PCR Fragment
0001 CCTGCTCGCA GGCTTGGCTT TCTCAGCTAA TGCCACGAAT CCGCCGAAAT GGGATCCAAA 
0061 CTACATAGTC AAAGGAACCC TGTACATTCC GTACGCCGAG ATTGCGGAAC CCTTCTACGC 
0121 CTGGTATGAC AAGAATACGA GGCGATCCCG CATCGATTAC TACGGCGGAA TGGTGAAGAC 
0181 ATACCAACTG GCTGGCGAGG GTCAGTACGG AACCCTGCTG AAGCTGGCAC CGATTACCAC 
0241 CAAGACGGAG AACAACAAGC TAACCTGTCT GCAGGTGAAT GGCACCGCCG ACCAGGCTGT 
0301 CGATATTCAG AGCATCCTGC CCGATGCGAA ACCTTT-CAG CCTGGTGGGC ACCGAATCCT 
0361 TTTTGGGCTA CACGTGCGAC AAGTTCCGCC TGGAGTCGAC AATTGGCCAA AAGAAGAACA 
0421 TCTATACGCT GTGGGTGCGG TACAAGAAGT CGCCGCATTA TCCCTCCAGC CGAATGCCCA 
0481 TTCCCGTGCG CTACGAGATG A 
 Assemble Data

8947R-2.IR_full       1   CCTGCTCGCAGGCTTGGCTTTCTCAGCTAATGCCACGAATCCGCCGAAATGGGATCCAAA 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8947R-2.in silico     1   CCTGCTCGCAGGCTTGGCTTTCTCAGCTAATGCCACGAATCCGCCGAAATGGGATCCAAA 60


8947R-2.IR_full       61  CTACATAGTCAAAGGAACCCTGTACATTCCGTACGCCGAGATTGCGGAACCCTTCTACGC 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8947R-2.in silico     61  CTACATAGTCAAAGGAACCCTGTACATTCCGTACGCCGAGATTGCGGAACCCTTCTACGC 120


8947R-2.IR_full       121 CTGGTATGACAAGAATACGAGGCGATCCCGCATCGATTACTACGGCGGAATGGTGAAGAC 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8947R-2.in silico     121 CTGGTATGACAAGAATACGAGGCGATCCCGCATCGATTACTACGGCGGAATGGTGAAGAC 180


8947R-2.IR_full       181 ATACCAACTGGCTGGCGAGGGTCAGTACGGAACCCTGCTGAAGCTGGCACCGATTACCAC 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8947R-2.in silico     181 ATACCAACTGGCTGGCGAGGGTCAGTACGGAACCCTGCTGAAGCTGGCACCGATTACCAC 240


8947R-2.IR_full       241 CAAGACGGAGAACAACAAGCTAACCTGTCTGCAGGTGAATGGCACCGCCGACCAGGCTGT 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8947R-2.in silico     241 CAAGACGGAGAACAACAAGCTAACCTGTCTGCAGGTGAATGGCACCGCCGACCAGGCTGT 300


8947R-2.IR_full       301 CGATATTCAGAGCATCCTGCCCGATGCGAAACCTTTNCAGCCTGGTGGGCACCGAATCCT 360
                          |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
8947R-2.in silico     301 CGATATTCAGAGCATCCTGCCCGATGCGAAACCTTT-CAGCCTGGTGGGCACCGAATCCT 360


8947R-2.IR_full       361 TTTTGGGCTACACGTGCGACAAGTTCCGCCTGGAGTCGACAATTGGCCAAAAGAAGAACA 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8947R-2.in silico     361 TTTTGGGCTACACGTGCGACAAGTTCCGCCTGGAGTCGACAATTGGCCAAAAGAAGAACA 420


8947R-2.IR_full       421 TCTATACGCTGTGGGTGCGGTACAAGAAGTCGCCGCATTATCCCTCCAGCCGAATGCCCA 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8947R-2.in silico     421 TCTATACGCTGTGGGTGCGGTACAAGAAGTCGCCGCATTATCCCTCCAGCCGAATGCCCA 480


8947R-2.IR_full       481 TTCCCGTGCGCTACGAGATGA 501
                          |||||||||||||||||||||
8947R-2.in silico     481 TTCCCGTGCGCTACGAGATGA 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_138985.2  CG8947-RA (26-29-p), mRNA 
0   NM_078804.2  CG4600-RA (yip2), mRNA 
0   NM_141095.2  CG11246-RA (Rpb8), mRNA 
0   NM_137181.1  CG16827-RA (alphaPS4), mRNA 
0   NM_132523.1  CG15741-RA (CG15741), mRNA 
0   NM_079497.2  CG9768-RA (hkb), mRNA 
0   NM_166019.1  CG18076-RH, transcript variant H (shot), mRNA 
0   NM_169061.1  CG18076-RH, transcript variant H (shot), mRNA,4,5,-tris-phosphate receptor CG1063-RA, transcript variant A (Itp-r83A), mRNA 
0   NM_143405.1  CG11842-RA (CG11842), mRNA 
0   NM_143759.2  CG6760-RA (l(3)70Da), mRNA 
0   NM_166075.1  CG30475-RA (CG30475), mRNA 
0   NM_169060.1  CG30475-RA (CG30475), mRNA,4,5,-tris-phosphate receptor CG1063-RB, transcript variant B (Itp-r83A), mRNA 
0   NM_078758.2  CG14027-RA (TotM), mRNA 
0   NM_001014722.1  CG12212-RB, transcript variant B (peb), mRNA 
0   NM_057326.4  CG12212-RA, transcript variant A (peb), mRNA 
0   NM_080121.2  CG7719-RA (gwl), mRNA 
0   NM_142484.1  CG7705-RA, transcript variant A (CG7705), mRNA 
0   NM_132183.1  CG15324-RA (CG15324), mRNA 
0   NM_057466.2  CG8896-RA (18w), mRNA 
0   NM_057542.2  CG6205-RA (por), mRNA 
0   NM_136595.1  CG13744-RA (CG13744), mRNA 
0   NM_140022.1  CG5087-RA (CG5087), mRNA 
0   NM_168605.1  CG6778-RB, transcript variant B (Aats-gly), mRNA 
0   NM_140489.2  CG6778-RA, transcript variant A (Aats-gly), mRNA 
0   NM_205987.1  CG32972-RA, transcript variant A (CG32972), mRNA 
0   NM_176037.1  CG32972-RB, transcript variant B (CG32972), mRNA 
0   NM_169777.1  CG7665-RB, transcript variant B (Fsh), mRNA 
0   NM_079669.2  CG7665-RA, transcript variant A (Fsh), mRNA 
0   NM_001031981.1  CG33722-RC, transcript variant C (CG33722), mRNA 
0   NM_001031982.1  CG33722-RB, transcript variant B (CG33722), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.