National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 8910R-1 
 Symbol CG8910  Full Name CG8910 
 CG No CG8910  Old CG No CG8910 
 Synonyms EG:EG0003.1, anon-WO0140519.220, CG8910 
 Accession No (Link to NCBI) NM_137323.3 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees pupal lethal 
 Map Viewer
 Reference
[Please submit your publication]
Du J, Zhang J, Su Y, Liu M, Ospina JK, Yang S, Zhu AJ.
In vivo RNAi screen reveals neddylation genes as novel regulators of Hedgehog signaling.
PLoS One (2011) 6(9) e24168 [ PubMed ID = 21931660 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGCCGTGGCTTCCAGCTCCAAT 
 Primer Seq. 3'
aatctagaggtaccTCACGCAGCAACGGAGCCAGT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GCCGNGGNTT CCAGCTCCAA TCACCTGGCA CCGcCATCGC CCACCACCCA CCATCACAGT 
0061 CATAGTCTGG CCTCACCCAC TCCATCGGGA TCATCGGGCA GTTCCCTTTC ACCGCGGGAA 
0121 AATGGAACTT CACATTCGCA TCATGGTGGG TGTCCCATTG GTTGCTCCGG TGCCGTGCCA 
0181 AGAAAACCGC TTCACACGCT CACCAATAGC TCATCCACGC CCATTTCCGG TTCATCGTCG 
0241 AGCGGAAGTG GGGGAGGAGG AGTGGGCAAC GGCAACGGTA GTGTACCAAG TGGAATGATG 
0301 ACGCCTACGC ATACGTATCC TGGCCGAAGG CATGNTAAAG AACCGACTGA TGGACATCCA 
0361 GAACCGCCTG CCGCCGATCA AGGAGTTCCG CAGTCCGGCC AAAGTGCCGC ATCCTTCGCC 
0421 CGTGCACGTC AGCAATCCCA GATTTCGTTA CTCCACTTAT ACAAAGTCCA GTGCCCATGA 
0481 ACTGGCTCCG TTGCTGCGTG A 
 in silico PCR Fragment
0001 GCCGTGGCTT CCAGCTCCAA TCACCTGGCA CCGCCATCGC CCACCACCCA CCATCACAGT 
0061 CATAGTCTGG CCTCACCCAC TCCATCGGGA TCATCGGGCA GTTCCCTTTC ACCGCGGGAA 
0121 AATGGAACTT CACATTCGCA TCATGGTGGG TGTCCCATTG GTTGCTCCGG TGCCGTGCCA 
0181 AGAAAACCGC TTCACACGCT CACCAATAGC TCATCCACGC CCATTTCCGG TTCATCGTCG 
0241 AGCGGAAGTG GGGGAGGAGG AGTGGGCAAC GGCAACGGTA GTGTACCAAG TGGAATGATG 
0301 ACGCCTACGC ATACGTATCC TGGCCGAAGG CATG-TAAAG AACCGACTGA TGGACATCCA 
0361 GAACCGCCTG CCGCCGATCA AGGAGTTCCG CAGTCCGGCC AAAGTGCCGC ATCCTTCGCC 
0421 CGTGCACGTC AGCAATCCCA GATTTCGTTA CTCCACTTAT ACAAAGTCCA GTGCCCATGA 
0481 ACTGGCTCCG TTGCTGCGTG A 
 Assemble Data

8910R-1.IR_full       1   GCCGNGGNTTCCAGCTCCAATCACCTGGCACCGCCATCGCCCACCACCCACCATCACAGT 60
                          |||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||
8910R-1.in silico     1   GCCGTGGCTTCCAGCTCCAATCACCTGGCACCGCCATCGCCCACCACCCACCATCACAGT 60


8910R-1.IR_full       61  CATAGTCTGGCCTCACCCACTCCATCGGGATCATCGGGCAGTTCCCTTTCACCGCGGGAA 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8910R-1.in silico     61  CATAGTCTGGCCTCACCCACTCCATCGGGATCATCGGGCAGTTCCCTTTCACCGCGGGAA 120


8910R-1.IR_full       121 AATGGAACTTCACATTCGCATCATGGTGGGTGTCCCATTGGTTGCTCCGGTGCCGTGCCA 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8910R-1.in silico     121 AATGGAACTTCACATTCGCATCATGGTGGGTGTCCCATTGGTTGCTCCGGTGCCGTGCCA 180


8910R-1.IR_full       181 AGAAAACCGCTTCACACGCTCACCAATAGCTCATCCACGCCCATTTCCGGTTCATCGTCG 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8910R-1.in silico     181 AGAAAACCGCTTCACACGCTCACCAATAGCTCATCCACGCCCATTTCCGGTTCATCGTCG 240


8910R-1.IR_full       241 AGCGGAAGTGGGGGAGGAGGAGTGGGCAACGGCAACGGTAGTGTACCAAGTGGAATGATG 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8910R-1.in silico     241 AGCGGAAGTGGGGGAGGAGGAGTGGGCAACGGCAACGGTAGTGTACCAAGTGGAATGATG 300


8910R-1.IR_full       301 ACGCCTACGCATACGTATCCTGGCCGAAGGCATGNTAAAGAACCGACTGATGGACATCCA 360
                          |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||
8910R-1.in silico     301 ACGCCTACGCATACGTATCCTGGCCGAAGGCATG-TAAAGAACCGACTGATGGACATCCA 360


8910R-1.IR_full       361 GAACCGCCTGCCGCCGATCAAGGAGTTCCGCAGTCCGGCCAAAGTGCCGCATCCTTCGCC 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8910R-1.in silico     361 GAACCGCCTGCCGCCGATCAAGGAGTTCCGCAGTCCGGCCAAAGTGCCGCATCCTTCGCC 420


8910R-1.IR_full       421 CGTGCACGTCAGCAATCCCAGATTTCGTTACTCCACTTATACAAAGTCCAGTGCCCATGA 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8910R-1.in silico     421 CGTGCACGTCAGCAATCCCAGATTTCGTTACTCCACTTATACAAAGTCCAGTGCCCATGA 480


8910R-1.IR_full       481 ACTGGCTCCGTTGCTGCGTGA 501
                          |||||||||||||||||||||
8910R-1.in silico     481 ACTGGCTCCGTTGCTGCGTGA 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_137323.3  CG8910-RA (CG8910), mRNA 
0.2   NM_130658.2  CG10260-RB (CG10260), mRNA 
0   NM_139904.1  CG8281-RA (CG8281), mRNA 
0   NM_168425.1  CG6391-RB, transcript variant B (Aps), mRNA 
0   NM_143339.1  CG4980-RA (CG4980), mRNA 
0   NM_166589.1  CG3134-RA (ord), mRNA 
0   NM_135854.2  CG16876-RA (CG16876), mRNA 
0   NM_139971.1  CG6915-RA (CG6915), mRNA 
0   11  NM_079453.2  CG6975-RA (gig), mRNA 
0   NM_132012.1  CG15776-RA (CG15776), mRNA 
0   NM_141040.1  CG7752-RA (Z4), mRNA 
0   NM_168646.1  CG32156-RC, transcript variant C (Mbs), mRNA 
0   NM_168648.1  CG32156-RB, transcript variant B (Mbs), mRNA 
0   NM_168647.1  CG32156-RA, transcript variant A (Mbs), mRNA 
0   NM_134516.2  CG32529-RA, transcript variant A (CG32529), mRNA 
0   NM_001042818.1  CG5055-RB, transcript variant B (baz), mRNA 
0   NM_078659.3  CG5055-RA, transcript variant A (baz), mRNA 
0   NM_142643.1  CG15923-RA (CG15923), mRNA 
0   NM_206153.1  CG33130-RC, transcript variant C (l(2)k07433), mRNA 
0   NM_206154.1  CG33130-RB, transcript variant B (l(2)k07433), mRNA 
0   NM_176218.1  CG33130-RA, transcript variant A (l(2)k07433), mRNA 
0   11  NM_167487.1  CG32577-RA (disco-r), mRNA 
0   NM_164996.1  CG31760-RA (CG31760), mRNA 
0   NM_168587.1  CG17697-RB, transcript variant B (fz), mRNA 
0   NM_080073.2  CG17697-RA, transcript variant A (fz), mRNA 
0   NM_001014741.1  CG11111-RC, transcript variant C (rdgB), mRNA 
0   NM_078594.2  CG11111-RB, transcript variant B (rdgB), mRNA 
0   NM_001014740.1  CG11111-RD, transcript variant D (rdgB), mRNA 
0   NM_167382.1  CG11111-RA, transcript variant A (rdgB), mRNA 
0   NM_206622.2  CG32776-RB, transcript variant B (CG32776), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.