National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 8896R-3 
 Symbol 18w  Full Name 18 wheeler 
 CG No CG8896  Old CG No CG8896 
 Synonyms toll, 18W, CT25100, tlr, l(2)00053, CG8896, 18w 
 Accession No (Link to NCBI) NM_057466.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
[Please submit your publication]
Lesch C, Jo J, Wu Y, Fish GS, Galko MJ.
A targeted UAS-RNAi screen in Drosophila larvae identifies wound closure genes regulating distinct cellular processes.
Genetics (2010) 186(3) 943-57 [ PubMed ID = 20813879 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   CTGCCTGCCTGTTGCTTCTTGTGGCTGATGCGCATGCGCAGCAGCAGTGCAACTGGCAGT 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  ACGGCCTCACCACCATGGACATCCGGTGCAGTGTCCGCGCTCTGGAGTCCGGCACCGGAA 120

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 CGCCACTTGACCTCCAGGTGGCGGAGGCGGCCGGCCGCCTGGATCTGCAGTGCAGCCAGG 180

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 AGCTCCTGCATGCCAGTGAACTGGCACCGGGACTCTTCCGGCAACTGCAGAAGCTCTCGG 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 AGCTGCGAATCGATGCCTGCAAACTGCAGCGAGTGCCTCCAAATGCATTTGAGGGTCTGA 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 TGTCGCTCAAGCGACTCACCCTGGAGTCACACAACGCGGTCTGGGGTCCGGGAAAGACCC 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 TGGAGTTGCACGGCCAGTCGTTCCAGGGACTGAAGGAGCTGTCCGAGCTGCACTTGGGCG 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 ACAACAATATCCGTCAGTTGCCCGAGGGCGTCTGGTGCTCCATGCCCAGCCTGCAACTGC 480

8896R-3.IR_full       481 TCAATCTCACCCAGAACCGG 500
                          |||||||||||||||||||| silico     481 TCAATCTCACCCAGAACCGG 500

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  18  NM_057466.2  CG8896-RA (18w), mRNA 
0.41   NM_079671.2  CG7847-RA, transcript variant A (sr), mRNA 
0.41   NM_169786.1  CG7847-RB, transcript variant B (sr), mRNA 
0.2   NM_141433.2  CG1104-RA, transcript variant A (CG1104), mRNA 
0   NM_079073.1  CG8595-RA (Toll-7), mRNA 
0   NM_139857.2  CG32380-RA, transcript variant A (SMSr), mRNA 
0   NM_168212.1  CG32380-RB, transcript variant B (SMSr), mRNA 
0   NM_079113.2  CG4012-RA (gek), mRNA 
0   NM_137195.2  CG8180-RA (CG8180), mRNA 
0   11  NM_078645.2  CG4252-RA (mei-41), mRNA 
0   NM_143182.2  CG5913-RA (CG5913), mRNA 
0   NM_164827.1  CG17834-RC, transcript variant C (CG17834), mRNA 
0   NM_135398.2  CG17834-RA, transcript variant A (CG17834), mRNA 
0   NM_167888.1  CG12090-RC, transcript variant C (CG12090), mRNA 
0   NM_167889.1  CG12090-RA, transcript variant A (CG12090), mRNA 
0   NM_139361.1  CG12090-RB, transcript variant B (CG12090), mRNA 
0   NM_132674.2  CG9938-RA (CG9938), mRNA 
0   NM_141181.2  CG1107-RB, transcript variant B (auxillin), mRNA 
0   NM_164317.2  CG1107-RA, transcript variant A (auxillin), mRNA 
0   NM_079617.3  CG7855-RA (timeout), mRNA 
0   NM_057614.2  CG4926-RA (Ror), mRNA 
0   NM_137135.2  CG12860-RA (CG12860), mRNA 
0   NM_001038982.1  CG33970-RA, transcript variant A (CG33970), mRNA 
0   NM_001038981.1  CG33970-RB, transcript variant B (CG33970), mRNA 
0   NM_078760.2  CG6992-RI (GluRIIA), mRNA 
0   NM_168228.1  CG32375-RA (CG32375), mRNA 
0   NM_166076.1  CG12424-RB, transcript variant B (CG12424), mRNA 
0   NM_137165.1  CG12424-RA, transcript variant A (CG12424), mRNA 
0   NM_166077.1  CG12424-RC, transcript variant C (CG12424), mRNA 
0   NM_168238.1  CG17888-RH, transcript variant H (Pdp1), mRNA 
 Wing Disc
JNK signal
Caspase-3 signal
Dcompartment   Penetrance

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.