National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 8881R-4 
 Symbol skpB  Full Name skpB 
 CG No CG8881  Old CG No CG8881 
 Synonyms CG8881, dskpB, skpB 
 Accession No (Link to NCBI) NM_136885.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Du J, Zhang J, Su Y, Liu M, Ospina JK, Yang S, Zhu AJ.
In vivo RNAi screen reveals neddylation genes as novel regulators of Hedgehog signaling.
PLoS ONE (2011) 6(9) e24168 [ PubMed ID = 21931660 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCCATCATTCGGCTGGAGTCTG 
 Primer Seq. 3'
aatctagaggtaccTCACACCACTCGTTCTCCTTG 
 Predicted Fragment Size
472 
 IR fragment full Seq
0001 CCATCATTCG GCTGGAGTCT GCGGACAAGG AGATCTTCGA CACGGATCAG GAGATCGCCA 
0061 AGTGCTCGGA AACGATTCGC ATTGCAATAG AGGATTTGGG CGATGAGAGC GACAACAGTG 
0121 TGCTGCCGTT GCCGAATGTC AACTCGCTGA TCCTGAAGAA AGTGCTCCAC TGGGCCACCT 
0181 ATCACAAGGA CGATCCTGTG GTTACCGAAG AGGTTGAGAA CAAGGAGAAG CGCACTGATG 
0241 ACATCTCATC CTGGGACGCT GACTTTCTCA AAGTCGACCA GGGCACGCTG TTCGAACTGA 
0301 TCCTCGCGGC AAACTACCTG AATATCCAGG GTCTGCTCGA CGTCACCTGC AAGACGGTGG 
0361 CCAATATGAT CAAGGGCAAG TCGCCGCAgG CTANTTTCGC GACACCTTCG CCATCCAGAA 
0421 TGACTTTCTG CCACAGGAGG AGGAACAGGT GCGCAAGGAG AACGAGTGGT GTGA 
 in silico PCR Fragment
0001 CCATCATTCG GCTGGAGTCT GCGGACAAGG AGATCTTTGA CACGGATCAG GAGATCGCCA 
0061 AGTGCTCGGA AACGATTCGC ATTGCAATAG AGGATTTGGG CGATGAGAGC GACAACAGTG 
0121 TGCTGCCGTT GCCGAATGTC AACTCGCTGA TCCTGAAGAA AGTGCTCCAC TGGGCCACCT 
0181 ATCACAAGGA CGATCCTGTG GTTACCGAAG AGGTTGAGAA CAAGGAGAAG CGCACTGATG 
0241 ACATCTCATC CTGGGACGCT GACTTTCTCA AAGTCGACCA GGGCACGCTG TTCGAACTGA 
0301 TCCTCGCGGC AAACTACCTG AATATCCAGG GTCTGCTCGA CGTCACCTGC AAGACGGTGG 
0361 CCAATATGAT CAAGGGCAAG TCGCCGCAGG CTA--TTCGC GACACCTTCG CCATCCAGAA 
0421 TGACTTTCTG CCACAGGAGG AGGAACAGGT GCGCAAGGAG AACGAGTGGT GTGA 
 Assemble Data

8881R-4.IR_full       1   CCATCATTCGGCTGGAGTCTGCGGACAAGGAGATCTTCGACACGGATCAGGAGATCGCCA 60
                          ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||
8881R-4.in silico     1   CCATCATTCGGCTGGAGTCTGCGGACAAGGAGATCTTTGACACGGATCAGGAGATCGCCA 60


8881R-4.IR_full       61  AGTGCTCGGAAACGATTCGCATTGCAATAGAGGATTTGGGCGATGAGAGCGACAACAGTG 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8881R-4.in silico     61  AGTGCTCGGAAACGATTCGCATTGCAATAGAGGATTTGGGCGATGAGAGCGACAACAGTG 120


8881R-4.IR_full       121 TGCTGCCGTTGCCGAATGTCAACTCGCTGATCCTGAAGAAAGTGCTCCACTGGGCCACCT 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8881R-4.in silico     121 TGCTGCCGTTGCCGAATGTCAACTCGCTGATCCTGAAGAAAGTGCTCCACTGGGCCACCT 180


8881R-4.IR_full       181 ATCACAAGGACGATCCTGTGGTTACCGAAGAGGTTGAGAACAAGGAGAAGCGCACTGATG 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8881R-4.in silico     181 ATCACAAGGACGATCCTGTGGTTACCGAAGAGGTTGAGAACAAGGAGAAGCGCACTGATG 240


8881R-4.IR_full       241 ACATCTCATCCTGGGACGCTGACTTTCTCAAAGTCGACCAGGGCACGCTGTTCGAACTGA 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8881R-4.in silico     241 ACATCTCATCCTGGGACGCTGACTTTCTCAAAGTCGACCAGGGCACGCTGTTCGAACTGA 300


8881R-4.IR_full       301 TCCTCGCGGCAAACTACCTGAATATCCAGGGTCTGCTCGACGTCACCTGCAAGACGGTGG 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8881R-4.in silico     301 TCCTCGCGGCAAACTACCTGAATATCCAGGGTCTGCTCGACGTCACCTGCAAGACGGTGG 360


8881R-4.IR_full       361 CCAATATGATCAAGGGCAAGTCGCCGCAGGCTANTTTCGCGACACCTTCGCCATCCAGAA 420
                          |||||||||||||||||||||||||||||||||  |||||||||||||||||||||||||
8881R-4.in silico     361 CCAATATGATCAAGGGCAAGTCGCCGCAGGCTA--TTCGCGACACCTTCGCCATCCAGAA 420


8881R-4.IR_full       421 TGACTTTCTGCCACAGGAGGAGGAACAGGTGCGCAAGGAGAACGAGTGGTGTGA 474
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||
8881R-4.in silico     421 TGACTTTCTGCCACAGGAGGAGGAACAGGTGCGCAAGGAGAACGAGTGGTGTGA 474

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   454  NM_136885.2  CG8881-RA (skpB), mRNA 
2.2   10  24  29  40  NM_166858.1  CG16983-RD, transcript variant D (skpA), mRNA 
2.2   10  24  29  40  NM_058042.3  CG16983-RA, transcript variant A (skpA), mRNA 
2.2   10  24  29  40  NM_166861.1  CG16983-RG, transcript variant G (skpA), mRNA 
2.2   10  24  29  40  NM_166856.1  CG16983-RB, transcript variant B (skpA), mRNA 
2.2   10  24  29  40  NM_166857.1  CG16983-RC, transcript variant C (skpA), mRNA 
2.2   10  24  29  40  NM_001038729.1  CG16983-RH, transcript variant H (skpA), mRNA 
2.2   10  24  29  40  NM_166860.1  CG16983-RF, transcript variant F (skpA), mRNA 
2.2   10  24  29  40  NM_166859.1  CG16983-RE, transcript variant E (skpA), mRNA 
1.1   16  NM_134514.1  CG11941-RA (skpC), mRNA 
0   17  NM_134513.2  CG12700-RA (skpD), mRNA 
0   21  37  NM_137952.2  CG12227-RA (skpF), mRNA 
0   21  35  NM_137951.1  CG5357-RA (CG5357), mRNA 
0   NM_143714.2  CG4746-RA (mab-2), mRNA 
0   NM_142291.2  CG14896-RA (CG14896), mRNA 
0   NM_137111.1  CG12505-RA (CG12505), mRNA 
0   NM_145334.1  CG10102-RA (CG10102), mRNA 
0   NM_132947.3  CG4875-RA, transcript variant A (CG4875), mRNA 
0   NM_206770.1  CG4875-RB, transcript variant B (CG4875), mRNA 
0   NM_132948.3  CG9099-RA (CG9099), mRNA 
0   NM_079051.2  CG4903-RA (MESR4), mRNA 
0   NM_141389.2  CG18048-RA (CG18048), mRNA 
0   NM_142868.1  CG13830-RA (CG13830), mRNA 
0   NM_132249.1  CG1440-RA (CG1440), mRNA 
0   NM_132612.1  CG4400-RA (CG4400), mRNA 
0   NM_001031985.1  CG33720-RA, transcript variant A (Pif1B), mRNA 
0   NM_001031987.1  CG33719-RA, transcript variant A (Pif1A), mRNA 
0   NM_140518.1  CG7439-RB, transcript variant B (AGO2), mRNA 
0   NM_168626.1  CG7439-RC, transcript variant C (AGO2), mRNA 
0   NM_131936.2  CG3556-RA (CG3556), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
 
DB
 
DC
DM
 
VM
 
VB
 
Caspase-3 signal
N
++ 
DB
DC
++ 
DM
VM
 
VB
 
Dcompartment   Penetrance
     

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.