National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 8878R-2 
 Symbol CG8878  Full Name CG8878 
 CG No CG8878  Old CG No CG8878 
 Synonyms VRK, BcDNA:LD23371, CG8878 
 Accession No (Link to NCBI) NM_136889.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
Read RD, Fenton TR, Gomez GG, Wykosky J, Vandenberg SR, Babic I, Iwanami A, Yang H, Cavenee WK, Mischel PS, Furnari FB, Thomas JB.
A kinome-wide RNAi screen in Drosophila Glia reveals that the RIO kinases mediate cell proliferation and survival through TORC2-Akt signaling in glioblastoma.
PLoS Genet. (2013) 9(2) e1003253 [ PubMed ID = 23459592 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||   |||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   GCAGCGCCAATGGCTTCGAGTTCCATGAGAACGACGATGAGGAGTCCTGCTCCTCGGCAG 60

                          ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| silico     61  GATCTGCTGCC-GGCACTGAGGCTGATCCCCCCACACTACTGCACACCCCGCAGGCACGC 120

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| silico     121 AGTCTGCTCTTGACGGGAGCCAGCATTGCCAGCGATCACAACAACTCCAGTGTGAT-GGA 180

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 GTCACCACGCCCGGTCTACACGCTCCGACCCTCGGTGGTCAACGGAACCATTCTGAGAGA 240

                          |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| silico     241 TGTGCTCTCCAAGGCCTGGCGCTTGGGCCGACCCATAGGAAAGGGCAACTTTGGCGAGAT 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 CTTCCTAGCCTCGGACGACACTGTTTGCCCTGCCAGCTCGGAGACAGCCAAGTACGTGGT 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 CAAAATTGAGCCGCATTCAAATGGGCCTCTGTTTGTTGAGATTCACTGTCTGATCAATAC 420

                          ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| silico     421 ATCCCGGAACAATGATTTATCAGATGCCGCAGAAGATGCTGCAAGCCTGCCAGCCCCACA 480

8878R-2.IR_full       481 GACGCATGTCCTCAGCAGGGGA 502
                          |||||||||||||||||||||| silico     481 GACGCATGTCCTCAGCAGGGGA 502

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_206099.1  CG8878-RB, transcript variant B (CG8878), mRNA 
100   482  NM_136889.2  CG8878-RA, transcript variant A (CG8878), mRNA 
0.41   NM_079022.2  CG18372-RA (AttB), mRNA 
0   NM_167090.1  CG14438-RB, transcript variant B (CG14438), mRNA 
0   NM_132120.1  CG14438-RA, transcript variant A (CG14438), mRNA 
0   NM_143815.2  CG3953-RA (l(3)IX-14), mRNA 
0   NM_001014564.1  CG7524-RE, transcript variant E (Src64B), mRNA 
0   NM_080195.2  CG7524-RB, transcript variant B (Src64B), mRNA 
0   NM_001014561.1  CG7524-RD, transcript variant D (Src64B), mRNA 
0   NM_001014562.1  CG7524-RC, transcript variant C (Src64B), mRNA 
0   NM_001014563.1  CG7524-RF, transcript variant F (Src64B), mRNA 
0   NM_168935.1  CG32447-RA, transcript variant A (CG32447), mRNA 
0   NM_206422.1  CG32447-RB, transcript variant B (CG32447), mRNA 
0   NM_166957.1  CG32793-RA (CG32793), mRNA 
0   NM_078933.2  CG11194-RA (Hey), mRNA 
0   NM_168832.1  CG32224-RA (CG32224), mRNA 
0   NM_140932.1  CG6996-RA (CG6996), mRNA 
0   NM_139729.2  CG5505-RE, transcript variant E (mule), mRNA 
0   NM_168134.1  CG5505-RC, transcript variant C (mule), mRNA 
0   NM_168132.1  CG5505-RD, transcript variant D (mule), mRNA 
0   NM_168131.1  CG5505-RA, transcript variant A (mule), mRNA 
0   NM_168133.1  CG5505-RF, transcript variant F (mule), mRNA 
0   NM_168135.1  CG5505-RB, transcript variant B (mule), mRNA 
0   NM_137968.1  CG17662-RA (CG17662), mRNA 
0   NM_079021.2  CG10146-RA (AttA), mRNA 
0   NM_132041.2  CG15765-RA (CG15765), mRNA 
0   NM_140567.2  CG6017-RA (CG6017), mRNA 
0   NM_140482.2  CG18649-RA (CG18649), mRNA 
0   11  NM_078670.2  CG7092-RA (Dhc16F), mRNA 
0   NM_140172.1  CG6310-RA (CG6310), mRNA 
 Wing Disc
JNK signal
Caspase-3 signal
Dcompartment   Penetrance

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.