National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 8878R-1 
 Symbol CG8878  Full Name CG8878 
 CG No CG8878  Old CG No CG8878 
 Synonyms VRK, BcDNA:LD23371, CG8878 
 Accession No (Link to NCBI) NM_136889.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Read RD, Fenton TR, Gomez GG, Wykosky J, Vandenberg SR, Babic I, Iwanami A, Yang H, Cavenee WK, Mischel PS, Furnari FB, Thomas JB.
A kinome-wide RNAi screen in Drosophila Glia reveals that the RIO kinases mediate cell proliferation and survival through TORC2-Akt signaling in glioblastoma.
PLoS Genet. (2013) 9(2) e1003253 [ PubMed ID = 23459592 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGCAGCGCCAATGGCTTCGAGT 
 Primer Seq. 3'
aatctagaggtaccTCCCCTGCTGAGGACATGCGT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GCANGCCCAA TGGCTTCGAG TTCCATGAGA ACGACGATGA GGAGTCCTGC TCCTCGGCAG 
0061 GATCTGCTGC CNGGCACTGA GGCTGATCCC CCCACACTAC TGCACACCCC GCAGGCACGC 
0121 AGTCTGCTCT TGACGGGAGC CAGCATTGCC AGCGATCACA ACAACTCCAG TGTGATNGGA 
0181 GTCACCACGC CCGGTCTACA CGCTCCGACC CTCGGTGGTC AACGGAACCA TTCTGAGAGA 
0241 TGTGCTCTCC AAGGCCTGGC GCTTGGGCCG ACCCATAGGA AAGGACAACT TTGGCGAGAT 
0301 CTTCCTAGCC TCGGACGACA CTGTTTGCCC TGCCAGCTCG GAGACAGCCA AGTACGTGGT 
0361 CAAAATTGAG CCGCATTCAA ATGGGCCTCT GTTTGTTGAG ATTCACTGTC TGATCAATAC 
0421 ATCCCGGAAC AATGATTTAT CAGATGCCGC AGAAGATGCT gNAAGCCTGC CAGCCCCACA 
0481 GACGCATGTC CTCAGCAGGG GA 
 in silico PCR Fragment
0001 GCAGCGCCAA TGGCTTCGAG TTCCATGAGA ACGACGATGA GGAGTCCTGC TCCTCGGCAG 
0061 GATCTGCTGC C-GGCACTGA GGCTGATCCC CCCACACTAC TGCACACCCC GCAGGCACGC 
0121 AGTCTGCTCT TGACGGGAGC CAGCATTGCC AGCGATCACA ACAACTCCAG TGTGAT-GGA 
0181 GTCACCACGC CCGGTCTACA CGCTCCGACC CTCGGTGGTC AACGGAACCA TTCTGAGAGA 
0241 TGTGCTCTCC AAGGCCTGGC GCTTGGGCCG ACCCATAGGA AAGGGCAACT TTGGCGAGAT 
0301 CTTCCTAGCC TCGGACGACA CTGTTTGCCC TGCCAGCTCG GAGACAGCCA AGTACGTGGT 
0361 CAAAATTGAG CCGCATTCAA ATGGGCCTCT GTTTGTTGAG ATTCACTGTC TGATCAATAC 
0421 ATCCCGGAAC AATGATTTAT CAGATGCCGC AGAAGATGCT GCAAGCCTGC CAGCCCCACA 
0481 GACGCATGTC CTCAGCAGGG GA 
 Assemble Data

8878R-1.IR_full       1   GCANGCCCAATGGCTTCGAGTTCCATGAGAACGACGATGAGGAGTCCTGCTCCTCGGCAG 60
                          |||   ||||||||||||||||||||||||||||||||||||||||||||||||||||||
8878R-1.in silico     1   GCAGCGCCAATGGCTTCGAGTTCCATGAGAACGACGATGAGGAGTCCTGCTCCTCGGCAG 60


8878R-1.IR_full       61  GATCTGCTGCCNGGCACTGAGGCTGATCCCCCCACACTACTGCACACCCCGCAGGCACGC 120
                          ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
8878R-1.in silico     61  GATCTGCTGCC-GGCACTGAGGCTGATCCCCCCACACTACTGCACACCCCGCAGGCACGC 120


8878R-1.IR_full       121 AGTCTGCTCTTGACGGGAGCCAGCATTGCCAGCGATCACAACAACTCCAGTGTGATNGGA 180
                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||
8878R-1.in silico     121 AGTCTGCTCTTGACGGGAGCCAGCATTGCCAGCGATCACAACAACTCCAGTGTGAT-GGA 180


8878R-1.IR_full       181 GTCACCACGCCCGGTCTACACGCTCCGACCCTCGGTGGTCAACGGAACCATTCTGAGAGA 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8878R-1.in silico     181 GTCACCACGCCCGGTCTACACGCTCCGACCCTCGGTGGTCAACGGAACCATTCTGAGAGA 240


8878R-1.IR_full       241 TGTGCTCTCCAAGGCCTGGCGCTTGGGCCGACCCATAGGAAAGGACAACTTTGGCGAGAT 300
                          |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||
8878R-1.in silico     241 TGTGCTCTCCAAGGCCTGGCGCTTGGGCCGACCCATAGGAAAGGGCAACTTTGGCGAGAT 300


8878R-1.IR_full       301 CTTCCTAGCCTCGGACGACACTGTTTGCCCTGCCAGCTCGGAGACAGCCAAGTACGTGGT 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8878R-1.in silico     301 CTTCCTAGCCTCGGACGACACTGTTTGCCCTGCCAGCTCGGAGACAGCCAAGTACGTGGT 360


8878R-1.IR_full       361 CAAAATTGAGCCGCATTCAAATGGGCCTCTGTTTGTTGAGATTCACTGTCTGATCAATAC 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8878R-1.in silico     361 CAAAATTGAGCCGCATTCAAATGGGCCTCTGTTTGTTGAGATTCACTGTCTGATCAATAC 420


8878R-1.IR_full       421 ATCCCGGAACAATGATTTATCAGATGCCGCAGAAGATGCTGNAAGCCTGCCAGCCCCACA 480
                          ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||
8878R-1.in silico     421 ATCCCGGAACAATGATTTATCAGATGCCGCAGAAGATGCTGCAAGCCTGCCAGCCCCACA 480


8878R-1.IR_full       481 GACGCATGTCCTCAGCAGGGGA 502
                          ||||||||||||||||||||||
8878R-1.in silico     481 GACGCATGTCCTCAGCAGGGGA 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_206099.1  CG8878-RB, transcript variant B (CG8878), mRNA 
100   482  NM_136889.2  CG8878-RA, transcript variant A (CG8878), mRNA 
0.41   NM_079022.2  CG18372-RA (AttB), mRNA 
0   NM_167090.1  CG14438-RB, transcript variant B (CG14438), mRNA 
0   NM_132120.1  CG14438-RA, transcript variant A (CG14438), mRNA 
0   NM_143815.2  CG3953-RA (l(3)IX-14), mRNA 
0   NM_001014564.1  CG7524-RE, transcript variant E (Src64B), mRNA 
0   NM_080195.2  CG7524-RB, transcript variant B (Src64B), mRNA 
0   NM_001014561.1  CG7524-RD, transcript variant D (Src64B), mRNA 
0   NM_001014562.1  CG7524-RC, transcript variant C (Src64B), mRNA 
0   NM_001014563.1  CG7524-RF, transcript variant F (Src64B), mRNA 
0   NM_168935.1  CG32447-RA, transcript variant A (CG32447), mRNA 
0   NM_206422.1  CG32447-RB, transcript variant B (CG32447), mRNA 
0   NM_166957.1  CG32793-RA (CG32793), mRNA 
0   NM_078933.2  CG11194-RA (Hey), mRNA 
0   NM_168832.1  CG32224-RA (CG32224), mRNA 
0   NM_140932.1  CG6996-RA (CG6996), mRNA 
0   NM_139729.2  CG5505-RE, transcript variant E (mule), mRNA 
0   NM_168134.1  CG5505-RC, transcript variant C (mule), mRNA 
0   NM_168132.1  CG5505-RD, transcript variant D (mule), mRNA 
0   NM_168131.1  CG5505-RA, transcript variant A (mule), mRNA 
0   NM_168133.1  CG5505-RF, transcript variant F (mule), mRNA 
0   NM_168135.1  CG5505-RB, transcript variant B (mule), mRNA 
0   NM_137968.1  CG17662-RA (CG17662), mRNA 
0   NM_079021.2  CG10146-RA (AttA), mRNA 
0   NM_132041.2  CG15765-RA (CG15765), mRNA 
0   NM_140567.2  CG6017-RA (CG6017), mRNA 
0   NM_140482.2  CG18649-RA (CG18649), mRNA 
0   11  NM_078670.2  CG7092-RA (Dhc16F), mRNA 
0   NM_140172.1  CG6310-RA (CG6310), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.