National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 8839R-3 
 Symbol CG8839  Full Name CG8839 
 CG No CG8839  Old CG No CG8839 
 Synonyms CG8839 
 Accession No (Link to NCBI) NM_136920.2 
 Inserted Chr. ll 
 Insertional Mutation  semi-lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   CTCCAGGCCTGCATTCGCTTTGTTTTCCGGCTGATCTATGGCCAAAAGGGTGAGAGTGTT 60

                          |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| silico     61  CCACCGATCACAGATGCCATTCTCTTGGAGTCCGCCACATCGTTGGCACGGAAAATCCGC 120

                          |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| silico     121 AAACAGGAGCTGAGCAGCGTCCAGGTCTTGGAATCATTTATCCGGCGCATCAAAGAGGTG 180

                          |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| silico     181 AATCCCATTCTCAACTGTGTCGTGGATGAACGTTACGATCAAGCTCTCAAGGAGGCAGCC 240

                          |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| silico     241 GAAGCAGATGCCCTGATCAAGTCT-GGACAATACAGCACGGAGGAGTTGGAGAAGGAGAA 300

                          | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 GCCCTTCCTGGGCGTGCCCATTACCACCAAGGATTGCATATCCGTCAAGGGCATGCTGCA 360

                          ||||||||||||||||||||||||||||||||||  |||||||||||||||||||||||| silico     361 CACAGCTGGACTCTTCGAACGTCGGGATGTGCGTGCTGCGCGGGATGCGGACGCTATGGC 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 CTTGATGCGCAAGGCGGGAGCCATTCCCATAGCCCTCACAAATGTTTCCGAGGTGTGCAT 480

8839R-3.IR_full       481 GTGGTGGGAGAGCAACAATAC 501
                          ||||||||||||||||||||| silico     481 GTGGTGGGAGAGCAACAATAC 501

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_165884.2  CG8839-RC, transcript variant C (CG8839), mRNA 
100   482  NM_165885.2  CG8839-RD, transcript variant D (CG8839), mRNA 
100   482  NM_165886.2  CG8839-RE, transcript variant E (CG8839), mRNA 
100   482  NM_136920.2  CG8839-RA, transcript variant A (CG8839), mRNA 
0   NM_001042868.1  CG34124-RA (CG34124), mRNA 
0   NM_134985.2  CG3054-RB, transcript variant B (l(2)k05819), mRNA 
0   NM_164582.1  CG3054-RA, transcript variant A (l(2)k05819), mRNA 
0   NM_176273.1  CG33166-RA, transcript variant A (stet), mRNA 
0   NM_176272.1  CG33166-RB, transcript variant B (stet), mRNA 
0   NM_139381.1  CG17249-RA (CG17249), mRNA 
0   NM_001014586.2  CG4609-RD, transcript variant D (fax), mRNA 
0   NM_176336.3  CG4609-RB, transcript variant B (fax), mRNA 
0   NM_001014587.2  CG4609-RC, transcript variant C (fax), mRNA 
0   NM_079382.5  CG4609-RA, transcript variant A (fax), mRNA 
0   NM_176581.2  CG33204-RA (CG33204), mRNA 
0   NM_078590.2  CG1771-RB, transcript variant B (mew), mRNA 
0   NM_167354.1  CG1771-RA, transcript variant A (mew), mRNA 
0   NM_134770.1  CG17657-RA (CG17657), mRNA 
0   NM_080132.2  CG11295-RA (l(2)dtl), mRNA 
0   NM_001014670.2  CG5462-RH, transcript variant H (scrib), mRNA 
0   NM_080015.2  CG5462-RD, transcript variant D (scrib), mRNA 
0   NM_166335.2  CG7097-RA, transcript variant A (CG7097), mRNA 
0   NM_170276.1  CG5462-RB, transcript variant B (scrib), mRNA 
0   NM_001014669.1  CG5462-RI, transcript variant I (scrib), mRNA 
0   NM_170275.1  CG5462-RA, transcript variant A (scrib), mRNA 
0   NM_001043296.1  CG5462-RG, transcript variant G (scrib), mRNA 
0   NM_170277.1  CG5462-RC, transcript variant C (scrib), mRNA 
0   NM_137567.1  CG9811-RA (Rgk1), mRNA 
0   NM_165478.1  CG30443-RA (Opbp), mRNA 
0   NM_166348.1  CG9325-RE, transcript variant E (hts), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.