National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 8839R-2 
 Symbol CG8839  Full Name CG8839 
 CG No CG8839  Old CG No CG8839 
 Synonyms CG8839 
 Accession No (Link to NCBI) NM_136920.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCTCCAGGCCTGCATTCGCTTT 
 Primer Seq. 3'
aatctagaggtaccGTATTGTTGCTCTCCCACCAC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CTCCAGGCCT GCATTCGCTT TGTTTTCCGG CTGATCTATG GCCAAAAGGG TGAGAGTGTT 
0061 CCACCGATCA CAGATGCCAT TCTCTTGGAG TCGGCCACAT CGTTGGCACG GAAAATCCGC 
0121 AAACAGGAGC TGAGCAGCGT CCAGGTCTTG GAGTCATTTA TCCGGCGCAT CAAAGAGGTN 
0181 AATCCCATTC TCAACTGTGT CGTGGATGAA CGCTACGATC AAGCTCTCAA GGAGGCAGCC 
0241 GAAGCAGATG CCCTGATCAA GTCTNGGACA ATACAGCACG GAGGAGTTGG AGAAGGAGAN 
0301 GNCCTTCCTG GGCGTGCCCA TTACCACCAA GGATTGCATA TCCGTCAAGG GCATGCTGCA 
0361 CACAGCTGGA CTCTTCGAAC GTCGGGATGT GCGtNNTGCG CGGGATGCGG ACGCTATGGC 
0421 CTTGATGCGC AAGGCGGGAG CCATTCCCAT AGCCCTCACA AATGTTTCCG AGGTGTGCAT 
0481 GTGGTGGGAG AGCAACAATA C 
 in silico PCR Fragment
0001 CTCCAGGCCT GCATTCGCTT TGTTTTCCGG CTGATCTATG GCCAAAAGGG TGAGAGTGTT 
0061 CCACCGATCA CAGATGCCAT TCTCTTGGAG TCCGCCACAT CGTTGGCACG GAAAATCCGC 
0121 AAACAGGAGC TGAGCAGCGT CCAGGTCTTG GAATCATTTA TCCGGCGCAT CAAAGAGGTG 
0181 AATCCCATTC TCAACTGTGT CGTGGATGAA CGTTACGATC AAGCTCTCAA GGAGGCAGCC 
0241 GAAGCAGATG CCCTGATCAA GTCT-GGACA ATACAGCACG GAGGAGTTGG AGAAGGAGAA 
0301 GCCCTTCCTG GGCGTGCCCA TTACCACCAA GGATTGCATA TCCGTCAAGG GCATGCTGCA 
0361 CACAGCTGGA CTCTTCGAAC GTCGGGATGT GCGTGCTGCG CGGGATGCGG ACGCTATGGC 
0421 CTTGATGCGC AAGGCGGGAG CCATTCCCAT AGCCCTCACA AATGTTTCCG AGGTGTGCAT 
0481 GTGGTGGGAG AGCAACAATA C 
 Assemble Data

8839R-2.IR_full       1   CTCCAGGCCTGCATTCGCTTTGTTTTCCGGCTGATCTATGGCCAAAAGGGTGAGAGTGTT 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8839R-2.in silico     1   CTCCAGGCCTGCATTCGCTTTGTTTTCCGGCTGATCTATGGCCAAAAGGGTGAGAGTGTT 60


8839R-2.IR_full       61  CCACCGATCACAGATGCCATTCTCTTGGAGTCGGCCACATCGTTGGCACGGAAAATCCGC 120
                          |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||
8839R-2.in silico     61  CCACCGATCACAGATGCCATTCTCTTGGAGTCCGCCACATCGTTGGCACGGAAAATCCGC 120


8839R-2.IR_full       121 AAACAGGAGCTGAGCAGCGTCCAGGTCTTGGAGTCATTTATCCGGCGCATCAAAGAGGTN 180
                          |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| 
8839R-2.in silico     121 AAACAGGAGCTGAGCAGCGTCCAGGTCTTGGAATCATTTATCCGGCGCATCAAAGAGGTG 180


8839R-2.IR_full       181 AATCCCATTCTCAACTGTGTCGTGGATGAACGCTACGATCAAGCTCTCAAGGAGGCAGCC 240
                          |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||
8839R-2.in silico     181 AATCCCATTCTCAACTGTGTCGTGGATGAACGTTACGATCAAGCTCTCAAGGAGGCAGCC 240


8839R-2.IR_full       241 GAAGCAGATGCCCTGATCAAGTCTNGGACAATACAGCACGGAGGAGTTGGAGAAGGAGAN 300
                          |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| 
8839R-2.in silico     241 GAAGCAGATGCCCTGATCAAGTCT-GGACAATACAGCACGGAGGAGTTGGAGAAGGAGAA 300


8839R-2.IR_full       301 GNCCTTCCTGGGCGTGCCCATTACCACCAAGGATTGCATATCCGTCAAGGGCATGCTGCA 360
                          | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8839R-2.in silico     301 GCCCTTCCTGGGCGTGCCCATTACCACCAAGGATTGCATATCCGTCAAGGGCATGCTGCA 360


8839R-2.IR_full       361 CACAGCTGGACTCTTCGAACGTCGGGATGTGCGTNNTGCGCGGGATGCGGACGCTATGGC 420
                          ||||||||||||||||||||||||||||||||||  ||||||||||||||||||||||||
8839R-2.in silico     361 CACAGCTGGACTCTTCGAACGTCGGGATGTGCGTGCTGCGCGGGATGCGGACGCTATGGC 420


8839R-2.IR_full       421 CTTGATGCGCAAGGCGGGAGCCATTCCCATAGCCCTCACAAATGTTTCCGAGGTGTGCAT 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8839R-2.in silico     421 CTTGATGCGCAAGGCGGGAGCCATTCCCATAGCCCTCACAAATGTTTCCGAGGTGTGCAT 480


8839R-2.IR_full       481 GTGGTGGGAGAGCAACAATAC 501
                          |||||||||||||||||||||
8839R-2.in silico     481 GTGGTGGGAGAGCAACAATAC 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_165884.2  CG8839-RC, transcript variant C (CG8839), mRNA 
100   482  NM_165885.2  CG8839-RD, transcript variant D (CG8839), mRNA 
100   482  NM_165886.2  CG8839-RE, transcript variant E (CG8839), mRNA 
100   482  NM_136920.2  CG8839-RA, transcript variant A (CG8839), mRNA 
0   NM_001042868.1  CG34124-RA (CG34124), mRNA 
0   NM_134985.2  CG3054-RB, transcript variant B (l(2)k05819), mRNA 
0   NM_164582.1  CG3054-RA, transcript variant A (l(2)k05819), mRNA 
0   NM_176273.1  CG33166-RA, transcript variant A (stet), mRNA 
0   NM_176272.1  CG33166-RB, transcript variant B (stet), mRNA 
0   NM_139381.1  CG17249-RA (CG17249), mRNA 
0   NM_001014586.2  CG4609-RD, transcript variant D (fax), mRNA 
0   NM_176336.3  CG4609-RB, transcript variant B (fax), mRNA 
0   NM_001014587.2  CG4609-RC, transcript variant C (fax), mRNA 
0   NM_079382.5  CG4609-RA, transcript variant A (fax), mRNA 
0   NM_176581.2  CG33204-RA (CG33204), mRNA 
0   NM_078590.2  CG1771-RB, transcript variant B (mew), mRNA 
0   NM_167354.1  CG1771-RA, transcript variant A (mew), mRNA 
0   NM_134770.1  CG17657-RA (CG17657), mRNA 
0   NM_080132.2  CG11295-RA (l(2)dtl), mRNA 
0   NM_001014670.2  CG5462-RH, transcript variant H (scrib), mRNA 
0   NM_080015.2  CG5462-RD, transcript variant D (scrib), mRNA 
0   NM_166335.2  CG7097-RA, transcript variant A (CG7097), mRNA 
0   NM_170276.1  CG5462-RB, transcript variant B (scrib), mRNA 
0   NM_001014669.1  CG5462-RI, transcript variant I (scrib), mRNA 
0   NM_170275.1  CG5462-RA, transcript variant A (scrib), mRNA 
0   NM_001043296.1  CG5462-RG, transcript variant G (scrib), mRNA 
0   NM_170277.1  CG5462-RC, transcript variant C (scrib), mRNA 
0   NM_137567.1  CG9811-RA (Rgk1), mRNA 
0   NM_165478.1  CG30443-RA (Opbp), mRNA 
0   NM_166348.1  CG9325-RE, transcript variant E (hts), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.