National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 8836R-2 
 Symbol Cpr49Ad  Full Name Cuticular protein 49Ad 
 CG No CG8836  Old CG No CG8836 
 Synonyms Cpr49Ad, CG8836 
 Accession No (Link to NCBI) NM_136929.1 
 Inserted Chr. lll 
 Insertional Mutation  lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Minami R, Sato C, Yamahama Y, Kubo H, Hariyama T, Kimura KI.
An RNAi Screen for Genes Involved in Nanoscale Protrusion Formation on Corneal Lens in Drosophila melanogaster.
Zool. Sci. (2016) 33(6) 583-591 [ PubMed ID = 27927092 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTGAAGCTGTTCTCCTGCCTTT 
 Primer Seq. 3'
aatctagaggtaccGTATAGACTACATTGGCAGGG 
 Predicted Fragment Size
484 
 IR fragment full Seq
0001 TGAAGCTGTT CTCCTGCCTT TTCGTGCTCA CCCTGGCTGC CATCGCCTGT GAGGGACAGC 
0061 CTCAATACAA TCCCTATCTG CGCAATCCCT ACTACAGGGA TCTCTACTAC AGGAACCGCG 
0121 ATCTCTACAA TCTACGACGT TTCTACGATG GCTTCTACAA GAAGTACAAT CCCTACATCG 
0181 CCGCTGCCCA GGCTAGAATT GTGGAGCAAA ACAATGATGT GAACTACGGA GCGGGCTCCT 
0241 ATTCCTACAA CTATGAGACG GAGAACGGCA TCCATGGCGA GGAGCGCGGA GTGCCAGTGA 
0301 ACATTGGAAA CCAGCAGCAA GAGGAGCAAG TTGAGGGTGC TTATTCGTTC ATTACACCCG 
0361 AGGGTCTGCG AGTGGGAGTC AAGTACCTGG CTGATGCCAA TGGTTTCCGT CCCGTGATCA 
0421 CCTATGATGG TGTGAACTCC GCTTTTTATG CCGGACAACC AGCCCCTGCC AATGTAGTCT 
0481 ATAC 
 in silico PCR Fragment
0001 TGAAGCTGTT CTCCTGCCTT TTCGTGCTCA CCCTGGCTGC CATCGCCTGT GAGGGACAGC 
0061 CTCAATACAA TCCCTATCTG CGCAATCCCT ACTACAGGGA TCTCTACTAC AGGAACCGCG 
0121 ATCTCTACAA TCTACGACGT TTCTACGATG GCTTCTACAA GAAGTACAAT CCCTACATCG 
0181 CCGCTGCCCA GGCTAGAATT GTGGAGCAAA ACAATGATGT GAACTACGGA GCGGGCTCCT 
0241 ATTCCTACAA CTATGAGACG GAGAACGGCA TCCATGGCGA GGAGCGCGGA GTGCCAGTGA 
0301 ACATTGGAAA CCAGCAGCAG GAGGAGCAAG TTGAGGGTGC TTATTCGTTC ATTACACCCG 
0361 AGGGTCTGCG AGTGGGAGTC AAGTACCTGG CTGATGCCAA TGGTTTCCGT CCCGTGATCA 
0421 CCTATGATGG TGTGAACTCC GCTTTTTATG CCGGACAGCC AGCCCCTGCC AATGTAGTCT 
0481 ATAC 
 Assemble Data

8836R-2.IR_full       1   TGAAGCTGTTCTCCTGCCTTTTCGTGCTCACCCTGGCTGCCATCGCCTGTGAGGGACAGC 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8836R-2.in silico     1   TGAAGCTGTTCTCCTGCCTTTTCGTGCTCACCCTGGCTGCCATCGCCTGTGAGGGACAGC 60


8836R-2.IR_full       61  CTCAATACAATCCCTATCTGCGCAATCCCTACTACAGGGATCTCTACTACAGGAACCGCG 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8836R-2.in silico     61  CTCAATACAATCCCTATCTGCGCAATCCCTACTACAGGGATCTCTACTACAGGAACCGCG 120


8836R-2.IR_full       121 ATCTCTACAATCTACGACGTTTCTACGATGGCTTCTACAAGAAGTACAATCCCTACATCG 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8836R-2.in silico     121 ATCTCTACAATCTACGACGTTTCTACGATGGCTTCTACAAGAAGTACAATCCCTACATCG 180


8836R-2.IR_full       181 CCGCTGCCCAGGCTAGAATTGTGGAGCAAAACAATGATGTGAACTACGGAGCGGGCTCCT 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8836R-2.in silico     181 CCGCTGCCCAGGCTAGAATTGTGGAGCAAAACAATGATGTGAACTACGGAGCGGGCTCCT 240


8836R-2.IR_full       241 ATTCCTACAACTATGAGACGGAGAACGGCATCCATGGCGAGGAGCGCGGAGTGCCAGTGA 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8836R-2.in silico     241 ATTCCTACAACTATGAGACGGAGAACGGCATCCATGGCGAGGAGCGCGGAGTGCCAGTGA 300


8836R-2.IR_full       301 ACATTGGAAACCAGCAGCAAGAGGAGCAAGTTGAGGGTGCTTATTCGTTCATTACACCCG 360
                          ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||
8836R-2.in silico     301 ACATTGGAAACCAGCAGCAGGAGGAGCAAGTTGAGGGTGCTTATTCGTTCATTACACCCG 360


8836R-2.IR_full       361 AGGGTCTGCGAGTGGGAGTCAAGTACCTGGCTGATGCCAATGGTTTCCGTCCCGTGATCA 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8836R-2.in silico     361 AGGGTCTGCGAGTGGGAGTCAAGTACCTGGCTGATGCCAATGGTTTCCGTCCCGTGATCA 420


8836R-2.IR_full       421 CCTATGATGGTGTGAACTCCGCTTTTTATGCCGGACAACCAGCCCCTGCCAATGTAGTCT 480
                          ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||
8836R-2.in silico     421 CCTATGATGGTGTGAACTCCGCTTTTTATGCCGGACAGCCAGCCCCTGCCAATGTAGTCT 480


8836R-2.IR_full       481 ATAC 484
                          ||||
8836R-2.in silico     481 ATAC 484

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   466  NM_136929.1  CG8836-RA (CG8836), mRNA 
0   NM_140786.1  CG18234-RB (CG18234), mRNA 
0   NM_001032052.1  CG33715-RE, transcript variant E (Msp-300), mRNA 
0   22  NM_079902.2  CG6741-RB, transcript variant B (a), mRNA 
0   22  NM_166514.1  CG6741-RA, transcript variant A (a), mRNA 
0   22  NM_001014543.1  CG6741-RC, transcript variant C (a), mRNA 
0   NM_078679.2  CG6816-RB, transcript variant B (Cyp18a1), mRNA 
0   NM_080253.2  CG5067-RA (cic), mRNA 
0   NM_167628.1  CG6816-RA, transcript variant A (Cyp18a1), mRNA 
0   NM_137829.1  CG10384-RA (CG10384), mRNA 
0   NM_138065.1  CG3419-RA, transcript variant A (CG3419), mRNA 
0   NM_206215.1  CG3419-RB, transcript variant B (CG3419), mRNA 
0   NM_136503.2  CG12769-RA, transcript variant A (CG12769), mRNA 
0   NM_165585.1  CG12769-RB, transcript variant B (CG12769), mRNA 
0   NM_137919.1  CG13545-RA (CG13545), mRNA 
0   15  NM_134890.2  CG17265-RA (CG17265), mRNA 
0   12  NM_166604.1  CG9812-RC, transcript variant C (CG9812), mRNA 
0   NM_132017.1  CG3160-RA (CG3160), mRNA 
0   NM_134576.2  CG1532-RA (CG1532), mRNA 
0   NM_057249.4  CG7793-RA (Sos), mRNA 
0   NM_169785.1  CG7223-RC, transcript variant C (htl), mRNA 
0   NM_169784.1  CG7223-RA, transcript variant A (htl), mRNA 
0   NM_176247.1  CG33143-RB, transcript variant B (CG33143), mRNA 
0   NM_176246.1  CG33143-RC, transcript variant C (CG33143), mRNA 
0   NM_139925.2  CG7979-RA (CG7979), mRNA 
0   NM_142421.2  CG7218-RA (CG7218), mRNA 
0   NM_132182.1  CG15326-RA (CG15326), mRNA 
0   10  NM_141639.1  CG16779-RA (CG16779), mRNA 
0   NM_132074.1  CG3585-RA (CG3585), mRNA 
0   NM_001043247.1  CG6535-RB (tefu), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.