National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  

Suspension of shipments during Golden Week Holidays: From 30 April to 14 May, deadline 17 April.

NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 8819R-3 
 Symbol achi  Full Name achintya 
 CG No CG8819  Old CG No CG8819 
 Synonyms CG8819, zaa, achi, ach 
 Accession No (Link to NCBI) NM_165911.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees semi-lethal 
 Map Viewer
[Please submit your publication]
Nitta Y, Yamazaki D, Sugie A, Hiroi M, Tabata T.
DISCO Interacting Protein 2 regulates axonal bifurcation and guidance of Drosophila mushroom body neurons.
Dev Biol (2017) 421(2) 233-244 [ PubMed ID = 27908785 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   GCCGGAACAAGAAGAGGTCAACATGGTCCTGGATCGCCATGTACGGCAGAATATCCAGGA 60

                          ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| silico     61  CATGATGCACGAGGCTCATGTCCAGGCGAGCCTGCTGGAGAACGAAGGACGCGGCCGTTT 120

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 CCACTCGGACTCAAGTTTGGACCAGGATTCTCTTCACGCTGACGTCATCGTGGAGGAGGA 180

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 TCAGAGCACCGAACACGGCGCCAACCAGGTGCAAAACTACCACGACATGATGGTGGACAG 240

                          ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| silico     241 TGAACACCACATCGACATAAATG-GGTCGCTGCGCAAACGTCGTGGAAATCTTCCCAAGA 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 CCTCTGTAAAGATTTTAAAGCGTTGGCTTTATGAGCACCGCTATAACGCCTATCCGAGCG 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 ATGCGGAGAAGTTCACCCTGTCCCAGGAGGCCAATCTGACGGTGCTCCAAGTGTGCAACT 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 GGTTCATCAATGCCCGTCGCCGCATTCTACCGGAGATGATCAGGCGCGAGGGCAACGATC 480

8819R-3.IR_full       481 CTCTGCACTTCACCATATNNC 501
                          ||||||||||||||||||  | silico     481 CTCTGCACTTCACCATATCGC 501

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_165911.1  CG8819-RA, transcript variant A (achi), mRNA 
100   482  NM_165912.1  CG8819-RC, transcript variant C (achi), mRNA 
47.09   227  122  46  43  NM_078990.2  CG8821-RA, transcript variant A (vis), mRNA 
47.09   227  122  46  43  NM_176157.1  CG8821-RB, transcript variant B (vis), mRNA 
0   NM_136599.2  CG8193-RA (CG8193), mRNA 
0   NM_080303.2  CG3707-RA, transcript variant A (wapl), mRNA 
0   NM_166931.1  CG3707-RB, transcript variant B (wapl), mRNA 
0   NM_140492.2  CG17081-RA (CG17081), mRNA 
0   NM_135342.2  CG8506-RA (CG8506), mRNA 
0   NM_206301.1  CG7986-RC, transcript variant C (Atg18), mRNA 
0   NM_139927.2  CG7986-RA, transcript variant A (Atg18), mRNA 
0   NM_168259.1  CG7986-RB, transcript variant B (Atg18), mRNA 
0   NM_165490.1  CG3427-RA (Epac), mRNA 
0   NM_140086.1  CG16717-RA (CG16717), mRNA 
0   NM_057744.2  CG1708-RA (cos), mRNA 
0   NM_166619.1  CG5411-RC, transcript variant C (Pde8), mRNA 
0   NM_166617.1  CG5411-RD, transcript variant D (Pde8), mRNA 
0   NM_166618.1  CG5411-RB, transcript variant B (Pde8), mRNA 
0   NM_137970.3  CG5411-RE, transcript variant E (Pde8), mRNA 
0   NM_166616.1  CG5411-RA, transcript variant A (Pde8), mRNA 
0   NM_079956.2  CG18455-RA, transcript variant A (Optix), mRNA 
0   NM_078548.2  CG2985-RA (Yp1), mRNA 
0   NM_140046.2  CG4452-RA, transcript variant A (CG4452), mRNA 
0   NM_168328.1  CG4452-RB, transcript variant B (CG4452), mRNA 
0   NM_168329.1  CG4452-RC, transcript variant C (CG4452), mRNA 
0   NM_135134.2  CG9092-RA (Gal), mRNA 
0   NM_168715.1  CG7930-RB, transcript variant B (TpnC73F), mRNA 
0   NM_079398.2  CG7930-RA, transcript variant A (TpnC73F), mRNA 
0   NM_001032051.1  CG33715-RD, transcript variant D (Msp-300), mRNA 
0   NM_134742.2  CG5001-RA (CG5001), mRNA 
 Wing Disc
JNK signal
Caspase-3 signal
Dcompartment   Penetrance

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.