National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 8819R-3 
 Symbol achi  Full Name achintya 
 CG No CG8819  Old CG No CG8819 
 Synonyms CG8819, zaa, achi, ach 
 Accession No (Link to NCBI) NM_165911.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees semi-lethal 
 Map Viewer
 Reference
[Please submit your publication]
Nitta Y, Yamazaki D, Sugie A, Hiroi M, Tabata T.<br> DISCO Interacting Protein 2 regulates axonal bifurcation and guidance of Drosophila mushroom body neurons.<br> Dev Biol (2017) 421(2) 233-244 [ PubMed ID = 27908785 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.<br> RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.<br> Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGCCGGAACAAGAAGAGGTCAA 
 Primer Seq. 3'
aatctagaggtaccGCGATATGGTGAAGTGCAGAG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GCCGGAACAA GAAGAGGTCA ACATGGTCCT GGATCGCCAT GTACGGCAGA ATATCCAGGA 
0061 CATGATGCAC GAGGCTCATG TCCAGGCGAG CCTGCTGGAG AACGAGGGAC GCGGCCGTTT 
0121 CCACTCGGAC TCAAGTTTGG ACCAGGATTC TCTTCACGCT GACGTCATCG TGGAGGAGGA 
0181 TCAGAGCACC GAACACGGCG CCAACCAGGT GCAAAACTAC CACGACATGA TGGTGGACAG 
0241 TGAACACCAC ATCGACATAA ATGNGGTCGC TGCGCAAACG TCGTGGAAAT CTTCCCAAGA 
0301 CCTCTGTAAA GATTTTAAAG CGTTGGCTTT ATGAGCACCG CTATAACGCC TATCCGAGCG 
0361 ATGCGGAGAA GTTCACCCTG TCCCAGGAGG CCAATCTGAC GGTGCTCCAA GTGTGCAACT 
0421 GGTTCATCAA TGCCCGTCGC CGCATTCTAC CGGAGATGAT CAGGCGCGAG GGCAACGATC 
0481 CTCTGCACTT CACCATATNN C 
 in silico PCR Fragment
0001 GCCGGAACAA GAAGAGGTCA ACATGGTCCT GGATCGCCAT GTACGGCAGA ATATCCAGGA 
0061 CATGATGCAC GAGGCTCATG TCCAGGCGAG CCTGCTGGAG AACGAAGGAC GCGGCCGTTT 
0121 CCACTCGGAC TCAAGTTTGG ACCAGGATTC TCTTCACGCT GACGTCATCG TGGAGGAGGA 
0181 TCAGAGCACC GAACACGGCG CCAACCAGGT GCAAAACTAC CACGACATGA TGGTGGACAG 
0241 TGAACACCAC ATCGACATAA ATG-GGTCGC TGCGCAAACG TCGTGGAAAT CTTCCCAAGA 
0301 CCTCTGTAAA GATTTTAAAG CGTTGGCTTT ATGAGCACCG CTATAACGCC TATCCGAGCG 
0361 ATGCGGAGAA GTTCACCCTG TCCCAGGAGG CCAATCTGAC GGTGCTCCAA GTGTGCAACT 
0421 GGTTCATCAA TGCCCGTCGC CGCATTCTAC CGGAGATGAT CAGGCGCGAG GGCAACGATC 
0481 CTCTGCACTT CACCATATCG C 
 Assemble Data
<PRE>

8819R-3.IR_full       1   GCCGGAACAAGAAGAGGTCAACATGGTCCTGGATCGCCATGTACGGCAGAATATCCAGGA 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8819R-3.in silico     1   GCCGGAACAAGAAGAGGTCAACATGGTCCTGGATCGCCATGTACGGCAGAATATCCAGGA 60


8819R-3.IR_full       61  CATGATGCACGAGGCTCATGTCCAGGCGAGCCTGCTGGAGAACGA<span class="snp"><tt>G</tt></span>GGACGCGGCCGTTT 120
                          |||||||||||||||||||||||||||||||||||||||||||||<span class="snp"><tt>&nbsp;</tt></span>||||||||||||||
8819R-3.in silico     61  CATGATGCACGAGGCTCATGTCCAGGCGAGCCTGCTGGAGAACGA<span class="snp"><tt>A</tt></span>GGACGCGGCCGTTT 120


8819R-3.IR_full       121 CCACTCGGACTCAAGTTTGGACCAGGATTCTCTTCACGCTGACGTCATCGTGGAGGAGGA 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8819R-3.in silico     121 CCACTCGGACTCAAGTTTGGACCAGGATTCTCTTCACGCTGACGTCATCGTGGAGGAGGA 180


8819R-3.IR_full       181 TCAGAGCACCGAACACGGCGCCAACCAGGTGCAAAACTACCACGACATGATGGTGGACAG 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8819R-3.in silico     181 TCAGAGCACCGAACACGGCGCCAACCAGGTGCAAAACTACCACGACATGATGGTGGACAG 240


8819R-3.IR_full       241 TGAACACCACATCGACATAAATG<span class="snp"><tt>N</tt></span>GGTCGCTGCGCAAACGTCGTGGAAATCTTCCCAAGA 300
                          |||||||||||||||||||||||<span class="snp"><tt>&nbsp;</tt></span>||||||||||||||||||||||||||||||||||||
8819R-3.in silico     241 TGAACACCACATCGACATAAATG<span class="snp"><tt>-</tt></span>GGTCGCTGCGCAAACGTCGTGGAAATCTTCCCAAGA 300


8819R-3.IR_full       301 CCTCTGTAAAGATTTTAAAGCGTTGGCTTTATGAGCACCGCTATAACGCCTATCCGAGCG 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8819R-3.in silico     301 CCTCTGTAAAGATTTTAAAGCGTTGGCTTTATGAGCACCGCTATAACGCCTATCCGAGCG 360


8819R-3.IR_full       361 ATGCGGAGAAGTTCACCCTGTCCCAGGAGGCCAATCTGACGGTGCTCCAAGTGTGCAACT 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8819R-3.in silico     361 ATGCGGAGAAGTTCACCCTGTCCCAGGAGGCCAATCTGACGGTGCTCCAAGTGTGCAACT 420


8819R-3.IR_full       421 GGTTCATCAATGCCCGTCGCCGCATTCTACCGGAGATGATCAGGCGCGAGGGCAACGATC 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8819R-3.in silico     421 GGTTCATCAATGCCCGTCGCCGCATTCTACCGGAGATGATCAGGCGCGAGGGCAACGATC 480


8819R-3.IR_full       481 CTCTGCACTTCACCATAT<span class="snp"><tt>N</tt></span><span class="snp"><tt>N</tt></span>C 501
                          ||||||||||||||||||<span class="snp"><tt>&nbsp;</tt></span><span class="snp"><tt>&nbsp;</tt></span>|
8819R-3.in silico     481 CTCTGCACTTCACCATAT<span class="snp"><tt>C</tt></span><span class="snp"><tt>G</tt></span>C 501

</PRE>
 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_165911.1  CG8819-RA, transcript variant A (achi), mRNA 
100   482  NM_165912.1  CG8819-RC, transcript variant C (achi), mRNA 
47.09   227  122  46  43  NM_078990.2  CG8821-RA, transcript variant A (vis), mRNA 
47.09   227  122  46  43  NM_176157.1  CG8821-RB, transcript variant B (vis), mRNA 
0   NM_136599.2  CG8193-RA (CG8193), mRNA 
0   NM_080303.2  CG3707-RA, transcript variant A (wapl), mRNA 
0   NM_166931.1  CG3707-RB, transcript variant B (wapl), mRNA 
0   NM_140492.2  CG17081-RA (CG17081), mRNA 
0   NM_135342.2  CG8506-RA (CG8506), mRNA 
0   NM_206301.1  CG7986-RC, transcript variant C (Atg18), mRNA 
0   NM_139927.2  CG7986-RA, transcript variant A (Atg18), mRNA 
0   NM_168259.1  CG7986-RB, transcript variant B (Atg18), mRNA 
0   NM_165490.1  CG3427-RA (Epac), mRNA 
0   NM_140086.1  CG16717-RA (CG16717), mRNA 
0   NM_057744.2  CG1708-RA (cos), mRNA 
0   NM_166619.1  CG5411-RC, transcript variant C (Pde8), mRNA 
0   NM_166617.1  CG5411-RD, transcript variant D (Pde8), mRNA 
0   NM_166618.1  CG5411-RB, transcript variant B (Pde8), mRNA 
0   NM_137970.3  CG5411-RE, transcript variant E (Pde8), mRNA 
0   NM_166616.1  CG5411-RA, transcript variant A (Pde8), mRNA 
0   NM_079956.2  CG18455-RA, transcript variant A (Optix), mRNA 
0   NM_078548.2  CG2985-RA (Yp1), mRNA 
0   NM_140046.2  CG4452-RA, transcript variant A (CG4452), mRNA 
0   NM_168328.1  CG4452-RB, transcript variant B (CG4452), mRNA 
0   NM_168329.1  CG4452-RC, transcript variant C (CG4452), mRNA 
0   NM_135134.2  CG9092-RA (Gal), mRNA 
0   NM_168715.1  CG7930-RB, transcript variant B (TpnC73F), mRNA 
0   NM_079398.2  CG7930-RA, transcript variant A (TpnC73F), mRNA 
0   NM_001032051.1  CG33715-RD, transcript variant D (Msp-300), mRNA 
0   NM_134742.2  CG5001-RA (CG5001), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
 
DB
 
DC
 
DM
 
VM
 
VB
 
Caspase-3 signal
N
DB
 
DC
++ 
DM
VM
VB
 
Dcompartment   Penetrance
     
 Pathways (updated: 2024/04/26)
 KEGG Pathway dme04350 : TGF-beta signaling pathway

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.