National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 8783R-2 
 Symbol CG8783  Full Name CG8783 
 CG No CG8783  Old CG No CG8783 
 Synonyms CG8783 
 Accession No (Link to NCBI) NM_140423.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgAATCCCCTGGCCGTAATCCTG 
 Primer Seq. 3'
aatctagaggtaccTGCTCGGTGAGATAGCCACTG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 AATCCCCTGG CCGTAATCCT GGTTTACTTC GATAGCAAGG GGGATCAGGT TACTGTACAG 
0061 GTATCCGTAC CAGACTCTCG GCCAAACGGA GGTGGCCAAC GACGAGCAGC GGAAGTCCAG 
0121 AAAGCGCAAT CCCTATGCCG TGGCCAATAC GGACGATCTG CTGCANGACA CCCACCCACT 
0181 TGGGTGCTGC CAAGAGCCAA GGACAACTGC AGGGATTCGC AGATGAGGTC CTGTCCGCTC 
0241 TGTTTGCTGT TAAACCACAG CTATGCAACC AAAAGTTTGA ACTCAAACTG AACGACGTAC 
0301 GCNTTTGTCA GTCATCCCAC TCTGATACCG CAAAAGGAGC AGAGAAGTGG TCCAATGGCC 
0361 AAGCAACAGA TGCTCATCAA CATTGTTTTT GCGCTGCATG CACAGGCCAG CTACTCGATT 
0421 GTTAAGTGCT ACCACGAACT GAGCAAGCGC CTTGGACTGG CGCTGAAGTT CGAGGAGCAG 
0481 CGCAGTGGCT ATCTCACCGA GCA 
 in silico PCR Fragment
0001 AATCCCCTGG CCGTAATCCT GGTTTACTTC GATAGCAAGG GGGATC-GGT TACTGTACAG 
0061 GTATCCGTAC CAGACTCTCG GCCAAACGGA GGTGGCCAAC GACGAGCAGC GGAAGTCCAG 
0121 AAAGCGCAAT CCCTATGCCG TGGCCAATAC GGACGATCTG CTGCA-GACA CCCACCCACT 
0181 TGGGTGCTGC CAAGAGCCAA GGACAACTGC AGGGATTCGC AGATGAGGTC CTGTCCGCTC 
0241 TGTTTGCTGT TAAACCACAG CTATGCAACC AAAAGTTTGA ACTCAAACTG AACGACGTAC 
0301 GC-TTTGTCA GTCATCCCAC TCTGATACCG CAAAAGGAGC AGAGAAGTGG TCCAATGGCC 
0361 AAGCAACAGA TGCTCATCAA CATTGTTTTT GCGCTGCATG CACAGGCCAG CTACTCGATT 
0421 GTTAAGTGCT ACCACGAACT GAGCAAGCGC CTTGGACTGG CGCTGAAGTT CGAGGAGCAG 
0481 CGCAGTGGCT ATCTCACCGA GCA 
 Assemble Data

8783R-2.IR_full       1   AATCCCCTGGCCGTAATCCTGGTTTACTTCGATAGCAAGGGGGATCAGGTTACTGTACAG 60
                          |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||
8783R-2.in silico     1   AATCCCCTGGCCGTAATCCTGGTTTACTTCGATAGCAAGGGGGATC-GGTTACTGTACAG 60


8783R-2.IR_full       61  GTATCCGTACCAGACTCTCGGCCAAACGGAGGTGGCCAACGACGAGCAGCGGAAGTCCAG 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8783R-2.in silico     61  GTATCCGTACCAGACTCTCGGCCAAACGGAGGTGGCCAACGACGAGCAGCGGAAGTCCAG 120


8783R-2.IR_full       121 AAAGCGCAATCCCTATGCCGTGGCCAATACGGACGATCTGCTGCANGACACCCACCCACT 180
                          ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||
8783R-2.in silico     121 AAAGCGCAATCCCTATGCCGTGGCCAATACGGACGATCTGCTGCA-GACACCCACCCACT 180


8783R-2.IR_full       181 TGGGTGCTGCCAAGAGCCAAGGACAACTGCAGGGATTCGCAGATGAGGTCCTGTCCGCTC 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8783R-2.in silico     181 TGGGTGCTGCCAAGAGCCAAGGACAACTGCAGGGATTCGCAGATGAGGTCCTGTCCGCTC 240


8783R-2.IR_full       241 TGTTTGCTGTTAAACCACAGCTATGCAACCAAAAGTTTGAACTCAAACTGAACGACGTAC 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8783R-2.in silico     241 TGTTTGCTGTTAAACCACAGCTATGCAACCAAAAGTTTGAACTCAAACTGAACGACGTAC 300


8783R-2.IR_full       301 GCNTTTGTCAGTCATCCCACTCTGATACCGCAAAAGGAGCAGAGAAGTGGTCCAATGGCC 360
                          || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8783R-2.in silico     301 GC-TTTGTCAGTCATCCCACTCTGATACCGCAAAAGGAGCAGAGAAGTGGTCCAATGGCC 360


8783R-2.IR_full       361 AAGCAACAGATGCTCATCAACATTGTTTTTGCGCTGCATGCACAGGCCAGCTACTCGATT 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8783R-2.in silico     361 AAGCAACAGATGCTCATCAACATTGTTTTTGCGCTGCATGCACAGGCCAGCTACTCGATT 420


8783R-2.IR_full       421 GTTAAGTGCTACCACGAACTGAGCAAGCGCCTTGGACTGGCGCTGAAGTTCGAGGAGCAG 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8783R-2.in silico     421 GTTAAGTGCTACCACGAACTGAGCAAGCGCCTTGGACTGGCGCTGAAGTTCGAGGAGCAG 480


8783R-2.IR_full       481 CGCAGTGGCTATCTCACCGAGCA 503
                          |||||||||||||||||||||||
8783R-2.in silico     481 CGCAGTGGCTATCTCACCGAGCA 503

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_168570.1  CG8783-RB, transcript variant B (CG8783), mRNA 
100   482  NM_140423.2  CG8783-RA, transcript variant A (CG8783), mRNA 
0   NM_169014.1  CG31531-RA, transcript variant A (CG31531), mRNA 
0   NM_176399.1  CG31531-RC, transcript variant C (CG31531), mRNA 
0   NM_133023.2  CG7846-RA (CG7846), mRNA 
0   NM_134789.1  CG15356-RA (CG15356), mRNA 
0   10  NM_166131.1  CG8322-RB, transcript variant B (ATPCL), mRNA 
0   10  NM_079031.1  CG8322-RA, transcript variant A (ATPCL), mRNA 
0   NM_140327.1  CG10522-RA (sti), mRNA 
0   NM_142122.2  CG7832-RA (CG7832), mRNA 
0   NM_168503.2  CG10632-RB (CG10632), mRNA 
0   NM_078961.3  CG12891-RA, transcript variant A (CPTI), mRNA 
0   NM_165777.2  CG12891-RB, transcript variant B (CPTI), mRNA 
0   NM_057996.3  CG7760-RA (cato), mRNA 
0   NM_139485.1  CG12187-RA (CG12187), mRNA 
0   NM_137546.2  CG15105-RA, transcript variant A (CG15105), mRNA 
0   NM_134951.2  CG2808-RA, transcript variant A (CG2808), mRNA 
0   NM_166318.1  CG15105-RB, transcript variant B (CG15105), mRNA 
0   NM_164547.1  CG2808-RB, transcript variant B (CG2808), mRNA 
0   NM_166172.3  CG6262-RB, transcript variant B (CG6262), mRNA 
0   NM_137279.3  CG6262-RA, transcript variant A (CG6262), mRNA 
0   NM_140571.3  CG5895-RA (CG5895), mRNA 
0   NM_168547.1  CG10738-RA, transcript variant A (CG10738), mRNA 
0   NM_140396.1  CG10738-RB, transcript variant B (CG10738), mRNA 
0   NM_169499.1  CG8449-RA (CG8449), mRNA 
0   NM_078845.3  CG15274-RA (GABA-B-R1), mRNA 
0   NM_166533.1  CG6339-RA (rad50), mRNA 
0   NM_079808.2  CG5658-RA (Klp98A), mRNA 
0   NM_168999.2  CG9805-RB, transcript variant B (eIF3-S10), mRNA 
0   NM_141213.2  CG9805-RA, transcript variant A (eIF3-S10), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.