National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 8783R-1 
 Symbol CG8783  Full Name CG8783 
 CG No CG8783  Old CG No CG8783 
 Synonyms CG8783 
 Accession No (Link to NCBI) NM_140423.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
[Please submit your publication]
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| silico     1   AATCCCCTGGCCGTAATCCTGGTTTACTTCGATAGCAAGGGGGATC-GGTTACTGTACAG 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  GTATCCGTACCAGACTCTCGGCCAAACGGAGGTGGCCAACGACGAGCAGCGGAAGTCCAG 120

                          ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| silico     121 AAAGCGCAATCCCTATGCCGTGGCCAATACGGACGATCTGCTGCA-GACACCCACCCACT 180

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 TGGGTGCTGCCAAGAGCCAAGGACAACTGCAGGGATTCGCAGATGAGGTCCTGTCCGCTC 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 TGTTTGCTGTTAAACCACAGCTATGCAACCAAAAGTTTGAACTCAAACTGAACGACGTAC 300

                          || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 GC-TTTGTCAGTCATCCCACTCTGATACCGCAAAAGGAGCAGAGAAGTGGTCCAATGGCC 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 AAGCAACAGATGCTCATCAACATTGTTTTTGCGCTGCATGCACAGGCCAGCTACTCGATT 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 GTTAAGTGCTACCACGAACTGAGCAAGCGCCTTGGACTGGCGCTGAAGTTCGAGGAGCAG 480

8783R-1.IR_full       481 CGCAGTGGCTATCTCACCGAGCA 503
                          ||||||||||||||||||||||| silico     481 CGCAGTGGCTATCTCACCGAGCA 503

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_168570.1  CG8783-RB, transcript variant B (CG8783), mRNA 
100   482  NM_140423.2  CG8783-RA, transcript variant A (CG8783), mRNA 
0   NM_169014.1  CG31531-RA, transcript variant A (CG31531), mRNA 
0   NM_176399.1  CG31531-RC, transcript variant C (CG31531), mRNA 
0   NM_133023.2  CG7846-RA (CG7846), mRNA 
0   NM_134789.1  CG15356-RA (CG15356), mRNA 
0   10  NM_166131.1  CG8322-RB, transcript variant B (ATPCL), mRNA 
0   10  NM_079031.1  CG8322-RA, transcript variant A (ATPCL), mRNA 
0   NM_140327.1  CG10522-RA (sti), mRNA 
0   NM_142122.2  CG7832-RA (CG7832), mRNA 
0   NM_168503.2  CG10632-RB (CG10632), mRNA 
0   NM_078961.3  CG12891-RA, transcript variant A (CPTI), mRNA 
0   NM_165777.2  CG12891-RB, transcript variant B (CPTI), mRNA 
0   NM_057996.3  CG7760-RA (cato), mRNA 
0   NM_139485.1  CG12187-RA (CG12187), mRNA 
0   NM_137546.2  CG15105-RA, transcript variant A (CG15105), mRNA 
0   NM_134951.2  CG2808-RA, transcript variant A (CG2808), mRNA 
0   NM_166318.1  CG15105-RB, transcript variant B (CG15105), mRNA 
0   NM_164547.1  CG2808-RB, transcript variant B (CG2808), mRNA 
0   NM_166172.3  CG6262-RB, transcript variant B (CG6262), mRNA 
0   NM_137279.3  CG6262-RA, transcript variant A (CG6262), mRNA 
0   NM_140571.3  CG5895-RA (CG5895), mRNA 
0   NM_168547.1  CG10738-RA, transcript variant A (CG10738), mRNA 
0   NM_140396.1  CG10738-RB, transcript variant B (CG10738), mRNA 
0   NM_169499.1  CG8449-RA (CG8449), mRNA 
0   NM_078845.3  CG15274-RA (GABA-B-R1), mRNA 
0   NM_166533.1  CG6339-RA (rad50), mRNA 
0   NM_079808.2  CG5658-RA (Klp98A), mRNA 
0   NM_168999.2  CG9805-RB, transcript variant B (eIF3-S10), mRNA 
0   NM_141213.2  CG9805-RA, transcript variant A (eIF3-S10), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.