National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
Notification of resumption of orders:

Orders have been suspended as a response to the COVID-19 infection, but it will be resumed today, May 11. However, we would like to set our organizational framework that prioritizes the maintenance of stocks for the time being. In addition, due to delays in delivery of postal items, it is expected that the flies you ordered will not reach you in normal period. We apologize for the inconvenience.

Thank you for your understanding.

NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 8776R-1 
 Symbol CG8776  Full Name CG8776 
 CG No CG8776  Old CG No CG8776 
 Synonyms CG13147, CG8776 
 Accession No (Link to NCBI) NM_165935.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgAAATGCCGCGTGGAGGAACGA 
 Primer Seq. 3'
aatctagaggtaccCTCACAGCACAGCATTACCAG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 AAATGCCGCG TNGGAGGAAC GACAACATCG CGCTATGAGG NAGGATCCAG ATAATGCATG 
0061 GAACTGCTGC TCCTGGTGCG AATACTTGCT GATCGTCATC CTGTCCACGA TCCTGCTGGT 
0121 GGGCGTGCTG GTGCTGACCC TCTTCTGGGT AATGTTCTAN CCGCGATGGC NTTCGCCTGG 
0181 TCGGAGAGTC CCAAGCAGCA GTTCAATCTG CATCCCATCC TCATGATTGC TGGCTTCGTC 
0241 ACGCTCTCCG GATTTTCCAT CTTGATCTAC CGTCTGTGCC GCTGCGTGAA GCAAATCTAT 
0301 GTGAAGCTGA TCCACATGTT CTTCCACGCC GTGGCCATTN CCGTGCATCG CCCTGGGTTT 
0361 CATATCCGTC TTCGCTTCCC ACGACGCGTT GCATAAGGTC AACTTCTATA GCCTCCACTC 
0421 GTGGCTGGGC TTCGTGACAA TGGGCATGTT CGTGCTCCAG TTTGTGATCG GCTTCTTCAG 
0481 CTTTCTGGTA ATGCTGTGCT GTGAG 
 in silico PCR Fragment
0001 AAATGCCGCG T-GGAGGAAC GACAACATCG CGCTATGAGG -AGGATCCAG ATAATGCCTG 
0061 GAATTGCTGC TCCTGGTGCG AATACTTGCT GATCGTCATC CTGTCCACGA TCCTGCTGGT 
0121 GGGCGTGCTG GTGCTAACCC TCTTCTGGGT GATGTTCTA- CCGCGATGGC -TTCGCCTGG 
0181 TCGGAGAGTC CCAAGCAGCA GTTCAATCTG CATCCCATCC TCATGATTGC TGGCTTCGTC 
0241 ACGCTCTCCG GATTTTCCAT CTTGATCTAT CGTCTGTGCC GCTGCGTGAA GCAAATCTAT 
0301 GTGAAGCTGA TCCACATGTT CTTCCACGCC GTGGCCATT- CCGTGCATCG CCCTGGGTTT 
0361 CATATCCGTC TTCGCTTCCC ACGACGCGTT GCATAAGGTC AACTTCTATA GCCTCCACTC 
0421 GTGGCTGGGC TTCGTGACAA TGGGCATGTT CGTGCTCCAG TTTGTGATCG GCTTCTTCAG 
0481 CTTTCTGGTA ATGCTGTGCT GTGAG 
 Assemble Data

8776R-1.IR_full       1   AAATGCCGCGTNGGAGGAACGACAACATCGCGCTATGAGGNAGGATCCAGATAATGCATG 60
                          ||||||||||| |||||||||||||||||||||||||||| |||||||||||||||| ||
8776R-1.in silico     1   AAATGCCGCGT-GGAGGAACGACAACATCGCGCTATGAGG-AGGATCCAGATAATGCCTG 60


8776R-1.IR_full       61  GAACTGCTGCTCCTGGTGCGAATACTTGCTGATCGTCATCCTGTCCACGATCCTGCTGGT 120
                          ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8776R-1.in silico     61  GAATTGCTGCTCCTGGTGCGAATACTTGCTGATCGTCATCCTGTCCACGATCCTGCTGGT 120


8776R-1.IR_full       121 GGGCGTGCTGGTGCTGACCCTCTTCTGGGTAATGTTCTANCCGCGATGGCNTTCGCCTGG 180
                          ||||||||||||||| |||||||||||||| |||||||| |||||||||| |||||||||
8776R-1.in silico     121 GGGCGTGCTGGTGCTAACCCTCTTCTGGGTGATGTTCTA-CCGCGATGGC-TTCGCCTGG 180


8776R-1.IR_full       181 TCGGAGAGTCCCAAGCAGCAGTTCAATCTGCATCCCATCCTCATGATTGCTGGCTTCGTC 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8776R-1.in silico     181 TCGGAGAGTCCCAAGCAGCAGTTCAATCTGCATCCCATCCTCATGATTGCTGGCTTCGTC 240


8776R-1.IR_full       241 ACGCTCTCCGGATTTTCCATCTTGATCTACCGTCTGTGCCGCTGCGTGAAGCAAATCTAT 300
                          ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||
8776R-1.in silico     241 ACGCTCTCCGGATTTTCCATCTTGATCTATCGTCTGTGCCGCTGCGTGAAGCAAATCTAT 300


8776R-1.IR_full       301 GTGAAGCTGATCCACATGTTCTTCCACGCCGTGGCCATTNCCGTGCATCGCCCTGGGTTT 360
                          ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||
8776R-1.in silico     301 GTGAAGCTGATCCACATGTTCTTCCACGCCGTGGCCATT-CCGTGCATCGCCCTGGGTTT 360


8776R-1.IR_full       361 CATATCCGTCTTCGCTTCCCACGACGCGTTGCATAAGGTCAACTTCTATAGCCTCCACTC 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8776R-1.in silico     361 CATATCCGTCTTCGCTTCCCACGACGCGTTGCATAAGGTCAACTTCTATAGCCTCCACTC 420


8776R-1.IR_full       421 GTGGCTGGGCTTCGTGACAATGGGCATGTTCGTGCTCCAGTTTGTGATCGGCTTCTTCAG 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8776R-1.in silico     421 GTGGCTGGGCTTCGTGACAATGGGCATGTTCGTGCTCCAGTTTGTGATCGGCTTCTTCAG 480


8776R-1.IR_full       481 CTTTCTGGTAATGCTGTGCTGTGAG 505
                          |||||||||||||||||||||||||
8776R-1.in silico     481 CTTTCTGGTAATGCTGTGCTGTGAG 505

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_136964.2  CG8776-RE, transcript variant E (CG8776), mRNA 
100   482  NM_165935.1  CG8776-RB, transcript variant B (CG8776), mRNA 
94.19   454  NM_165937.1  CG8776-RD, transcript variant D (CG8776), mRNA 
94.19   454  NM_165934.1  CG8776-RA, transcript variant A (CG8776), mRNA 
94.19   454  NM_165936.1  CG8776-RC, transcript variant C (CG8776), mRNA 
0   NM_134477.1  CG14204-RA (CG14204), mRNA 
0   NM_135076.2  CG14024-RA (CG14024), mRNA 
0   NM_132259.2  CG11219-RA (PIP82), mRNA 
0   NM_169478.1  CG6148-RA, transcript variant A (Past1), mRNA 
0   NM_079608.2  CG6148-RB, transcript variant B (Past1), mRNA 
0   NM_176312.2  CG33205-RA, transcript variant A (CG33205), mRNA 
0   NM_176308.2  CG33205-RB, transcript variant B (CG33205), mRNA 
0   NM_176309.2  CG33205-RC, transcript variant C (CG33205), mRNA 
0   NM_132212.2  CG1575-RA (CG1575), mRNA 
0   NM_169032.1  CG10233-RB, transcript variant B (CG10233), mRNA 
0   NM_141263.2  CG10233-RA, transcript variant A (CG10233), mRNA 
0   NM_206266.1  CG12008-RB, transcript variant B (kst), mRNA 
0   NM_080212.1  CG5832-RA (Hmx), mRNA 
0   NM_001042816.1  CG9907-RC, transcript variant C (para), mRNA 
0   NM_001042815.1  CG9907-RB, transcript variant B (para), mRNA 
0   NM_078647.3  CG9907-RA, transcript variant A (para), mRNA 
0   NM_138200.2  CG12030-RA (CG12030), mRNA 
0   NM_141866.2  CG14728-RA (sad), mRNA 
0   NM_166100.1  CG30471-RA (CG30471), mRNA 
0   NM_206628.1  CG32767-RB, transcript variant B (CG32767), mRNA 
0   NM_131975.3  CG32767-RA, transcript variant A (CG32767), mRNA 
0   NM_167012.1  CG7035-RA, transcript variant A (Cbp80), mRNA 
0   NM_080011.2  CG7035-RB, transcript variant B (Cbp80), mRNA 
0   NM_166115.2  CG30080-RA (CG30080), mRNA 
0   NM_079106.2  CG4817-RA (Ssrp), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.