National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
Notification of resumption of orders:

Orders have been suspended as a response to the COVID-19 infection, but it will be resumed today, May 11. However, we would like to set our organizational framework that prioritizes the maintenance of stocks for the time being. In addition, due to delays in delivery of postal items, it is expected that the flies you ordered will not reach you in normal period. We apologize for the inconvenience.

Thank you for your understanding.

NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 8770R-3 
 Symbol Gbeta76C  Full Name G protein beta-subunit 76C 
 CG No CG8770  Old CG No CG8770 
 Synonyms Gbeta76C, Gbe, Gbeta, G[q], Gbetae, DGqbeta, G[[beta]]e, gbe, G[[beta]], Gbeta[[e]], Gqbeta, CG8770 
 Accession No (Link to NCBI) NM_078996.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGCCGAAAATTGACCCAGAAAC 
 Primer Seq. 3'
aatctagaggtaccGAGCCGGTGATCAGATGGCCA 
 Predicted Fragment Size
498 
 IR fragment full Seq
0001 GCCGAAAATT GACCCAGAAA CACAAAAACT CTACGACGAA ATCAATGGCA TGATACAGAA 
0061 GTTTAAGGAT GACCAAAAAA GCAAGGCTGA TTGCACGTTG GCCGATAAAT GCGGCGACAT 
0121 GGGGGATGTG CCCAAGATTC GATTCTCATC CAAGAAGATT CTCAAGGGCC ACATCAACAA 
0181 GGTGAATTCG GTGCATTTTG CCGGGGACTC GCGGCACTGC GTCACTGGAT CGCTGGACGG 
0241 CAAGCTGATC ATCTGGGACA CCTGGACCGC CAACAAGGTG CAGATCATCC CCTTGAGATC 
0301 CGCCTGGGTA ATGACGGTGG CCTTTTCGCC GTCGGGTAAC TTTGTGGCCT GCGGAGGAAT 
0361 GGACAACCAG TGCACCGTCT ACGATGTGAA CAATCGCGAT GCCTCCGGAG TGGCCAAGAT 
0421 GGTCAAAGAG CTGATGGGCT ACGAGGGATT CCTCAGCTCC TGTCGCTTCC TCGACGATGG 
0481 CCATCTGATC ACCGGCTC 
 in silico PCR Fragment
0001 GCCGAAAATT GACCCAGAAA CACAAAAACT CTACGACGAA ATCAATGGCA TGATACAGAA 
0061 GTTTAAGGAT GACCAAAAAA GCAAGGCTGA TTGCACGTTG GCCGATAAAT GCGGCGACAT 
0121 GGGGGATGTG CCCAAGATTC GATTCTCATC CAAGAAGATT CTCAAGGGCC ACATCAACAA 
0181 GGTGAATTCG GTGCATTTTG CCGGGGACTC GCGGCACTGC GTCACTGGAT CGCTGGACGG 
0241 CAAGCTGATC ATCTGGGACA CCTGGACCGC CAACAAGGTG CAGATCATCC CCTTGAGATC 
0301 CGCCTGGGTA ATGACGGTGG CCTTTTCGCC GTCGGGTAAC TTTGTGGCCT GCGGAGGAAT 
0361 GGACAACCAG TGCACCGTCT ACGATGTGAA CAATCGCGAT GCCTCCGGAG TGGCCAAGAT 
0421 GGTCAAAGAG CTGATGGGCT ACGAGGGATT CCTCAGCTCC TGTCGCTTCC TCGACGATGG 
0481 CCATCTGATC ACCGGCTC 
 Assemble Data

8770R-3.IR_full       1   GCCGAAAATTGACCCAGAAACACAAAAACTCTACGACGAAATCAATGGCATGATACAGAA 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8770R-3.in silico     1   GCCGAAAATTGACCCAGAAACACAAAAACTCTACGACGAAATCAATGGCATGATACAGAA 60


8770R-3.IR_full       61  GTTTAAGGATGACCAAAAAAGCAAGGCTGATTGCACGTTGGCCGATAAATGCGGCGACAT 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8770R-3.in silico     61  GTTTAAGGATGACCAAAAAAGCAAGGCTGATTGCACGTTGGCCGATAAATGCGGCGACAT 120


8770R-3.IR_full       121 GGGGGATGTGCCCAAGATTCGATTCTCATCCAAGAAGATTCTCAAGGGCCACATCAACAA 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8770R-3.in silico     121 GGGGGATGTGCCCAAGATTCGATTCTCATCCAAGAAGATTCTCAAGGGCCACATCAACAA 180


8770R-3.IR_full       181 GGTGAATTCGGTGCATTTTGCCGGGGACTCGCGGCACTGCGTCACTGGATCGCTGGACGG 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8770R-3.in silico     181 GGTGAATTCGGTGCATTTTGCCGGGGACTCGCGGCACTGCGTCACTGGATCGCTGGACGG 240


8770R-3.IR_full       241 CAAGCTGATCATCTGGGACACCTGGACCGCCAACAAGGTGCAGATCATCCCCTTGAGATC 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8770R-3.in silico     241 CAAGCTGATCATCTGGGACACCTGGACCGCCAACAAGGTGCAGATCATCCCCTTGAGATC 300


8770R-3.IR_full       301 CGCCTGGGTAATGACGGTGGCCTTTTCGCCGTCGGGTAACTTTGTGGCCTGCGGAGGAAT 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8770R-3.in silico     301 CGCCTGGGTAATGACGGTGGCCTTTTCGCCGTCGGGTAACTTTGTGGCCTGCGGAGGAAT 360


8770R-3.IR_full       361 GGACAACCAGTGCACCGTCTACGATGTGAACAATCGCGATGCCTCCGGAGTGGCCAAGAT 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8770R-3.in silico     361 GGACAACCAGTGCACCGTCTACGATGTGAACAATCGCGATGCCTCCGGAGTGGCCAAGAT 420


8770R-3.IR_full       421 GGTCAAAGAGCTGATGGGCTACGAGGGATTCCTCAGCTCCTGTCGCTTCCTCGACGATGG 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8770R-3.in silico     421 GGTCAAAGAGCTGATGGGCTACGAGGGATTCCTCAGCTCCTGTCGCTTCCTCGACGATGG 480


8770R-3.IR_full       481 CCATCTGATCACCGGCTC 498
                          ||||||||||||||||||
8770R-3.in silico     481 CCATCTGATCACCGGCTC 498

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   480  NM_078996.2  CG8770-RA (Gbeta76C), mRNA 
0   11  NM_142067.2  CG9925-RA (CG9925), mRNA 
0   NM_141925.1  CG10035-RA (CG10035), mRNA 
0   NM_078867.2  CG5526-RA (Dhc36C), mRNA 
0   NM_134833.4  CG9866-RA, transcript variant A (CG9866), mRNA 
0   NM_164481.1  CG9866-RB, transcript variant B (CG9866), mRNA 
0   NM_079630.2  CG4236-RA (Caf1), mRNA 
0   NM_057401.3  CG3068-RA (aur), mRNA 
0   NM_136608.2  CG8777-RA (CG8777), mRNA 
0   NM_132791.2  CG12608-RA (CG12608), mRNA 
0   NM_139863.3  CG8560-RA (CG8560), mRNA 
0   NM_137702.1  CG15654-RA (CG15654), mRNA 
0   NM_165802.1  CG30015-RA, transcript variant A (CG30015), mRNA 
0   NM_136777.2  CG30015-RB, transcript variant B (CG30015), mRNA 
0   NM_165794.2  CG11895-RA (stan), mRNA 
0   NM_001038740.1  CG32776-RD, transcript variant D (CG32776), mRNA 
0   NM_206622.2  CG32776-RB, transcript variant B (CG32776), mRNA 
0   NM_166996.2  CG32776-RA, transcript variant A (CG32776), mRNA 
0   NM_001038741.1  CG32776-RC, transcript variant C (CG32776), mRNA 
0   NM_132198.2  CG1530-RA (CG1530), mRNA 
0   NM_143430.2  CG15817-RB, transcript variant B (CG15817), mRNA 
0   NM_170403.1  CG15817-RA, transcript variant A (CG15817), mRNA 
0   NM_134617.2  CG14614-RA (CG14614), mRNA 
0   NM_079244.2  CG7558-RA (Arp66B), mRNA 
0   NM_132582.1  CG1824-RA (CG1824), mRNA 
0   NM_140493.2  CG16959-RA, transcript variant A (CG16959), mRNA 
0   NM_168608.1  CG16959-RB, transcript variant B (CG16959), mRNA 
0   NM_168808.1  CG8756-RC, transcript variant C (LCBP1), mRNA 
0   NM_168809.1  CG8756-RA, transcript variant A (LCBP1), mRNA 
0   NM_140885.1  CG8756-RD, transcript variant D (LCBP1), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.