National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
Notification of resumption of orders:

Orders have been suspended as a response to the COVID-19 infection, but it will be resumed today, May 11. However, we would like to set our organizational framework that prioritizes the maintenance of stocks for the time being. In addition, due to delays in delivery of postal items, it is expected that the flies you ordered will not reach you in normal period. We apologize for the inconvenience.

Thank you for your understanding.

NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 8756R-1 
 Symbol LCBP1  Full Name LDLa domain containing chitin binding protein 1 
 CG No CG8756  Old CG No CG8756 
 Synonyms CG8756, LCBP1, verm, Verm 
 Accession No (Link to NCBI) NM_140885.1 
 Inserted Chr. lll 
 Insertional Mutation  lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Minami R, Sato C, Yamahama Y, Kubo H, Hariyama T, Kimura KI.
An RNAi Screen for Genes Involved in Nanoscale Protrusion Formation on Corneal Lens in Drosophila melanogaster.
Zool. Sci. (2016) 33(6) 583-591 [ PubMed ID = 27927092 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTGGCGCGTTGGTGGCCAATTT 
 Primer Seq. 3'
aatctagaggtaccAGAGCAGGCGTTCTCATCGGA 
 Predicted Fragment Size
428 
 IR fragment full Seq
0001 TGGCGCGTTG GTGGCCAATT TTGAGCGTTG TGTGCCTCTG CCTTGCTGTC TGCACATGGC 
0061 CAGGACAAGC TGGAGGGCGT TGATGTGGAG GAGGTGTGCG CCGATCGTCC CGCGGATGAG 
0121 TACTTCCGCC TGGAGACCGA CGGCGACTGC CGCGAGGTGT ACAGATGTAC CAAGTCGGGT 
0181 TTGAAAGAAA TTCAGTGTCC TTCGGGTCTG GCCTTCGACG TGATCAAGCA GACCTGCGAC 
0241 TGGAAGGCCA AGGTGACCAA TTGCGACGAG AAAGAGAAGC CGCGCAAGGC CAAGCCCATC 
0301 CTGAAGACGG ATGAGCCCAT CTGTCCCGAG GAGTAAGCTG TCCTGCGGCG ACGGCGAGTG 
0361 CCTGGACAAG GAGCTCTTCT GCAACGGCAA GTCCGACTGC AAGGACGAAT CCGATGAGAA 
0421 CGCCTGCTCT  
 in silico PCR Fragment
0001 TGGCGCGTTG GTGGCCAATT TTGAGCGTTG TGTGCCTCTG CCTTGCTGT- TGCACATGGC 
0061 CAGGACAAGC TGGAGGGCGT TGATGTGGAG GAGGTGTGCG CCGATCGTCC CGCGGATGAG 
0121 TACTTCCGCC TGGAGACCGA CGGCGACTGC CGCGAGGTGT ACAGATGTAC CAAGTCGGGT 
0181 TTGAAAGAAA TTCAGTGTCC TTCGGGTCTG GCCTTCGACG TGATCAAGCA GACCTGCGAC 
0241 TGGAAGGCCA AGGTGACCAA TTGCGACGAG AAAGAGAAGC CGCGCAAGGC CAAGCCCATC 
0301 CTGAAGACGG ATGAGCCCAT CTGTCCCGAG G-GTAAGCTG TCCTGCGGCG ACGGCGAGTG 
0361 CCTGGACAAG GAGCTCTTCT GCAACGGCAA GTCCGACTGC AAGGACGAAT CCGATGAGAA 
0421 CGCCTGCTCT  
 Assemble Data

8756R-1.IR_full       1   TGGCGCGTTGGTGGCCAATTTTGAGCGTTGTGTGCCTCTGCCTTGCTGTCTGCACATGGC 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||
8756R-1.in silico     1   TGGCGCGTTGGTGGCCAATTTTGAGCGTTGTGTGCCTCTGCCTTGCTGT-TGCACATGGC 60


8756R-1.IR_full       61  CAGGACAAGCTGGAGGGCGTTGATGTGGAGGAGGTGTGCGCCGATCGTCCCGCGGATGAG 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8756R-1.in silico     61  CAGGACAAGCTGGAGGGCGTTGATGTGGAGGAGGTGTGCGCCGATCGTCCCGCGGATGAG 120


8756R-1.IR_full       121 TACTTCCGCCTGGAGACCGACGGCGACTGCCGCGAGGTGTACAGATGTACCAAGTCGGGT 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8756R-1.in silico     121 TACTTCCGCCTGGAGACCGACGGCGACTGCCGCGAGGTGTACAGATGTACCAAGTCGGGT 180


8756R-1.IR_full       181 TTGAAAGAAATTCAGTGTCCTTCGGGTCTGGCCTTCGACGTGATCAAGCAGACCTGCGAC 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8756R-1.in silico     181 TTGAAAGAAATTCAGTGTCCTTCGGGTCTGGCCTTCGACGTGATCAAGCAGACCTGCGAC 240


8756R-1.IR_full       241 TGGAAGGCCAAGGTGACCAATTGCGACGAGAAAGAGAAGCCGCGCAAGGCCAAGCCCATC 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8756R-1.in silico     241 TGGAAGGCCAAGGTGACCAATTGCGACGAGAAAGAGAAGCCGCGCAAGGCCAAGCCCATC 300


8756R-1.IR_full       301 CTGAAGACGGATGAGCCCATCTGTCCCGAGGAGTAAGCTGTCCTGCGGCGACGGCGAGTG 360
                          ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||
8756R-1.in silico     301 CTGAAGACGGATGAGCCCATCTGTCCCGAGG-GTAAGCTGTCCTGCGGCGACGGCGAGTG 360


8756R-1.IR_full       361 CCTGGACAAGGAGCTCTTCTGCAACGGCAAGTCCGACTGCAAGGACGAATCCGATGAGAA 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8756R-1.in silico     361 CCTGGACAAGGAGCTCTTCTGCAACGGCAAGTCCGACTGCAAGGACGAATCCGATGAGAA 420


8756R-1.IR_full       421 CGCCTGCTCT 430
                          ||||||||||
8756R-1.in silico     421 CGCCTGCTCT 430

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   428  NM_168808.1  CG8756-RC, transcript variant C (LCBP1), mRNA 
96.72   414  NM_168809.1  CG8756-RA, transcript variant A (LCBP1), mRNA 
66.12   283  NM_140885.1  CG8756-RD, transcript variant D (LCBP1), mRNA 
61.91   265  NM_168810.1  CG8756-RB, transcript variant B (LCBP1), mRNA 
0   NM_136827.2  CG7745-RA (CG7745), mRNA 
0   NM_134528.1  CG9572-RA (CG9572), mRNA 
0   NM_166183.1  CG8332-RB, transcript variant B (RpS15), mRNA 
0   NM_137292.2  CG8332-RA, transcript variant A (RpS15), mRNA 
0   NM_058030.3  CG4581-RA (Thiolase), mRNA 
0   15  NM_001032051.1  CG33715-RD, transcript variant D (Msp-300), mRNA 
0   NM_140814.1  CG3893-RA (CG3893), mRNA 
0   NM_206228.1  CG18214-RF, transcript variant F (trio), mRNA 
0   NM_167849.1  CG18214-RB, transcript variant B (trio), mRNA 
0   NM_139976.1  CG6765-RA (CG6765), mRNA 
0   NM_130635.2  CG3078-RA (CG3078), mRNA 
0   NM_137722.3  CG30391-RA (CG30391), mRNA 
0   NM_176741.1  CG3525-RE, transcript variant E (eas), mRNA 
0   NM_167490.1  CG3525-RB, transcript variant B (eas), mRNA 
0   NM_078640.2  CG3525-RA, transcript variant A (eas), mRNA 
0   NM_167489.1  CG3525-RD, transcript variant D (eas), mRNA 
0   NM_167491.1  CG3525-RC, transcript variant C (eas), mRNA 
0   NM_079700.1  CG3723-RA (Dhc93AB), mRNA 
0   NM_139687.2  CG10671-RA, transcript variant A (CG10671), mRNA 
0   NM_168110.2  CG10671-RB, transcript variant B (CG10671), mRNA 
0   NM_139626.1  CG1273-RB (CG1273), mRNA 
0   NM_001031989.2  CG33936-RC, transcript variant C (CG33936), mRNA 
0   NM_001031988.2  CG33936-RD, transcript variant D (CG33936), mRNA 
0   NM_001031992.1  CG33937-RB, transcript variant B (CG33937), mRNA 
0   NM_001031993.1  CG33937-RA, transcript variant A (CG33937), mRNA 
0   NM_143313.1  CG5639-RA (CG5639), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.