National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 8742R-3 
 Symbol Gyc76C  Full Name Guanylyl cyclase at 76C 
 CG No CG8742  Old CG No CG8742 
 Synonyms DrGC-1, GYC 76C, CG8742, DGC1, drgc, unnamed, CG32215, Gyc76C 
 Accession No (Link to NCBI) NM_079441.3 
 Inserted Chr. lll 
 Insertional Mutation  2 lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees pupal lethal 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCAGAAAAGTACTTGCGCAGAG 
 Primer Seq. 3'
aatctagaggtaccGCAGGGCATGTTGTTCGAGTT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CAGAAAAGTA CTTGCGCAGA GTGGATCAAA TAACATTCAT GTCCAATTGC CATAGCACGG 
0061 AGAACTTCAA TCAAATGGCC CGCAGTCTTC TCGTCGTGGC ATCCACGCCA CCCACAAAGG 
0121 ATTACATACA GTTCACTAAA CAAGTGCAGA AGTACAGCTC AAAGCCGCCG TTCAATTTGG 
0181 AAATTCCCAG GCTGTTTGTA GAAAGTAATT TTAGCAAGTT CATATCGATC TATGCCGCGT 
0241 ACCTGTACGA TTCGGTAAAG CTGTATGCCT GGGCTGTGGA CAAAATGCTG CGGGAGGAGA 
0301 CCCGAGTCTT GACCGATGAT GTGATCTTCG AGGTGGCCAG CAACGGAACA CGTGTAATCG 
0361 ATACCATAAT CAAAAACCGT ACTTATATGA GCATAACTGG ATCCAAAATT AAGATCGATC 
0421 AATATGGCGA TTCGGAGGGT AATTTTTCGG TCCTGGCCTA CAAGCCACAC AAGTGGAATA 
0481 ACTCGAACAA CACTTGCCCT GC 
 in silico PCR Fragment
0001 CAGAAAAGTA CTTGCGCAGA GTGGATCAAA TAACATTCAT GTCCAATTGC CATAGCACGG 
0061 AGAACTTCAA TCAAATGGCC CGCAGTCTTC TCGTCGTGGC ATCCACGCCA CCCACAAAGG 
0121 ATTACATACA GTTCACTAAA CAAGTGCAGA AGTACAGCTC AAAGCCGCCG TTCAATTTGG 
0181 AAATTCCCAG GCTGTTTGTA GAAAGTAATT TTAGCAAGTT CATATCGATC TATGCCGCGT 
0241 ACCTGTACGA TTCGGTAAAG CTGTATGCCT GGGCTGTGGA CAAAATGCTG CGGGAGGAGA 
0301 CCCGAGTCTT GACCGATGAT GTGATCTTCG AGGTGGCCAG CAACGGAACA CGTGTAATCG 
0361 ATACCATAAT CAAAAACCGT ACTTATATGA GCATAACTGG ATCCAAAATT AAGATCGATC 
0421 AATATGGCGA TTCGGAGGGT AATTTTTCGG TCCTGGCCTA CAAGCCACAC AAGTGGAATA 
0481 ACTCGAACAA CA--TGCCCT GC 
 Assemble Data

8742R-3.IR_full       1   CAGAAAAGTACTTGCGCAGAGTGGATCAAATAACATTCATGTCCAATTGCCATAGCACGG 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8742R-3.in silico     1   CAGAAAAGTACTTGCGCAGAGTGGATCAAATAACATTCATGTCCAATTGCCATAGCACGG 60


8742R-3.IR_full       61  AGAACTTCAATCAAATGGCCCGCAGTCTTCTCGTCGTGGCATCCACGCCACCCACAAAGG 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8742R-3.in silico     61  AGAACTTCAATCAAATGGCCCGCAGTCTTCTCGTCGTGGCATCCACGCCACCCACAAAGG 120


8742R-3.IR_full       121 ATTACATACAGTTCACTAAACAAGTGCAGAAGTACAGCTCAAAGCCGCCGTTCAATTTGG 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8742R-3.in silico     121 ATTACATACAGTTCACTAAACAAGTGCAGAAGTACAGCTCAAAGCCGCCGTTCAATTTGG 180


8742R-3.IR_full       181 AAATTCCCAGGCTGTTTGTAGAAAGTAATTTTAGCAAGTTCATATCGATCTATGCCGCGT 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8742R-3.in silico     181 AAATTCCCAGGCTGTTTGTAGAAAGTAATTTTAGCAAGTTCATATCGATCTATGCCGCGT 240


8742R-3.IR_full       241 ACCTGTACGATTCGGTAAAGCTGTATGCCTGGGCTGTGGACAAAATGCTGCGGGAGGAGA 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8742R-3.in silico     241 ACCTGTACGATTCGGTAAAGCTGTATGCCTGGGCTGTGGACAAAATGCTGCGGGAGGAGA 300


8742R-3.IR_full       301 CCCGAGTCTTGACCGATGATGTGATCTTCGAGGTGGCCAGCAACGGAACACGTGTAATCG 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8742R-3.in silico     301 CCCGAGTCTTGACCGATGATGTGATCTTCGAGGTGGCCAGCAACGGAACACGTGTAATCG 360


8742R-3.IR_full       361 ATACCATAATCAAAAACCGTACTTATATGAGCATAACTGGATCCAAAATTAAGATCGATC 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8742R-3.in silico     361 ATACCATAATCAAAAACCGTACTTATATGAGCATAACTGGATCCAAAATTAAGATCGATC 420


8742R-3.IR_full       421 AATATGGCGATTCGGAGGGTAATTTTTCGGTCCTGGCCTACAAGCCACACAAGTGGAATA 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8742R-3.in silico     421 AATATGGCGATTCGGAGGGTAATTTTTCGGTCCTGGCCTACAAGCCACACAAGTGGAATA 480


8742R-3.IR_full       481 ACTCGAACAACACTTGCCCTGC 502
                          ||||||||||||  ||||||||
8742R-3.in silico     481 ACTCGAACAACA--TGCCCTGC 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_001007096.1  CG8742-RB, transcript variant B (Gyc76C), mRNA 
100   482  NM_001007095.1  CG8742-RC, transcript variant C (Gyc76C), mRNA 
100   482  NM_079441.3  CG8742-RA, transcript variant A (Gyc76C), mRNA 
0   NM_137570.1  CG10051-RA (CG10051), mRNA 
0   NM_141791.1  CG4800-RA (Tctp), mRNA 
0   NM_079803.2  CG6127-RA (Ser), mRNA 
0   NM_078516.2  CG12690-RA (CHES-1-like), mRNA 
0   NM_138136.2  CG30427-RB, transcript variant B (CG30427), mRNA 
0   NM_169910.1  CG4141-RB, transcript variant B (Pi3K92E), mRNA 
0   NM_142645.2  CG4141-RA, transcript variant A (Pi3K92E), mRNA 
0   NM_166699.1  CG30427-RD, transcript variant D (CG30427), mRNA 
0   NM_166698.1  CG30427-RA, transcript variant A (CG30427), mRNA 
0   NM_166697.1  CG30427-RC, transcript variant C (CG30427), mRNA 
0   NM_165026.1  CG16975-RA, transcript variant A (CG16975), mRNA 
0   NM_135762.2  CG16975-RB, transcript variant B (CG16975), mRNA 
0   NM_136666.2  CG12926-RA (CG12926), mRNA 
0   NM_079873.3  CG1945-RA, transcript variant A (faf), mRNA 
0   NM_170576.1  CG1945-RC, transcript variant C (faf), mRNA 
0   NM_057598.3  CG10739-RA (pigeon), mRNA 
0   NM_167275.1  CG32668-RA (CG32668), mRNA 
0   NM_139563.2  CG10359-RA (CG10359), mRNA 
0   NM_168757.1  CG8127-RD, transcript variant D (Eip75B), mRNA 
0   NM_168755.1  CG8127-RB, transcript variant B (Eip75B), mRNA 
0   NM_079409.2  CG8127-RA, transcript variant A (Eip75B), mRNA 
0   NM_168756.1  CG8127-RC, transcript variant C (Eip75B), mRNA 
0   NM_079772.1  CG11922-RA (fd96Cb), mRNA 
0   NM_168893.2  CG9391-RB, transcript variant B (CG9391), mRNA 
0   NM_141037.3  CG9391-RA, transcript variant A (CG9391), mRNA 
0   NM_134933.1  CG2774-RA (CG2774), mRNA 
0   NM_143702.2  CG5889-RA (Mdh), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.