National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 8740R-4 
 Symbol CG8740  Full Name CG8740 
 CG No CG8740  Old CG No CG8740 
 Synonyms BcDNA:GH05582, CG8740 
 Accession No (Link to NCBI) NM_136567.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   ATGCACAGCTCCCAGCAGCCGGCGGAGCGTCTGCCGCTCACCAAGGGCCGCACCGTGAAC 60

                          ||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||| silico     61  GGTCTGGTCAAGCGCTTGTCAATGGAGCGCTTCTCCCCGCAGCCGGCGA-TCAGCCAGCC 120

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 GGCCTTTTCTTACATTCGGCCCAACGAGGGCATCACATATGCCCAGCTGGATCTGGGCGA 180

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 GGATCAAGTCCGACGATCGCCAATGGACCGAGATGTCCGCACACCCCAGAGGGAGTTCGC 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 TCCTGCTCGGCCGCCGAGGGCCAGCGATGTGAGGCCCAGTTACTCGCCCACATCCAATGG 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 CGCTCCTTTGGCCAGCAGGCCCAGTCATTCGCCTTCGCCATGGCAGCAGCTGAGTCCCCG 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 CAATCTAAGCGACGAGGACGAGGGCTTGGGTTACGAGCCCAGGAAGGTATACTATGAGGA 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 GGAGTTCCCCCGAAGGTCGGAACCTCCCATTGTGCCCGTCATCAGGAGTGTCAGCCCCTC 480

8740R-4.IR_full       481 GCCCTACTTGGACGAGTTGGG 501
                          ||||||||||||||||||||| silico     481 GCCCTACTTGGACGAGTTGGG 501

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_165627.1  CG8740-RC, transcript variant C (CG8740), mRNA 
100   482  NM_165626.1  CG8740-RB, transcript variant B (CG8740), mRNA 
100   482  NM_136567.2  CG8740-RA, transcript variant A (CG8740), mRNA 
0.2   NM_176244.1  CG9696-RE, transcript variant E (dom), mRNA 
0.2   NM_166446.1  CG9696-RD, transcript variant D (dom), mRNA 
0.2   NM_080094.2  CG9696-RA, transcript variant A (dom), mRNA 
0   NM_079205.3  CG7507-RA, transcript variant A (Dhc64C), mRNA 
0   NM_168103.1  CG7507-RB, transcript variant B (Dhc64C), mRNA 
0   NM_001043133.1  CG32045-RD, transcript variant D (fry), mRNA 
0   NM_168357.2  CG32045-RB, transcript variant B (fry), mRNA 
0   NM_169846.1  CG31043-RB, transcript variant B (gukh), mRNA 
0   NM_169845.1  CG31043-RA, transcript variant A (gukh), mRNA 
0   NM_001032021.1  CG31043-RC, transcript variant C (gukh), mRNA 
0   NM_166554.1  CG3612-RA (blw), mRNA 
0   NM_137273.2  CG8060-RA (CG8060), mRNA 
0   NM_137889.2  CG13533-RA (asrij), mRNA 
0   NM_206469.1  CG11870-RD, transcript variant D (CG11870), mRNA 
0   NM_169337.2  CG11870-RB, transcript variant B (CG11870), mRNA 
0   NM_206470.1  CG11870-RC, transcript variant C (CG11870), mRNA 
0   NM_141734.2  CG11870-RA, transcript variant A (CG11870), mRNA 
0   NM_142840.2  CG4723-RA (CG4723), mRNA 
0   NM_078725.2  CG4276-RD, transcript variant D (aru), mRNA 
0   NM_164393.1  CG4276-RA, transcript variant A (aru), mRNA 
0   NM_164395.1  CG4276-RC, transcript variant C (aru), mRNA 
0   NM_132996.2  CG5675-RA (X11L), mRNA 
0   NM_142361.2  CG5319-RA (CG5319), mRNA 
0   NM_141390.1  CG10296-RA (CG10296), mRNA 
0   NM_168153.1  CG32406-RA (CG32406), mRNA 
0   NM_137456.2  CG5733-RA (CG5733), mRNA 
0   NM_134517.2  CG15618-RA (CG15618), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.