National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 8740R-2 
 Symbol CG8740  Full Name CG8740 
 CG No CG8740  Old CG No CG8740 
 Synonyms BcDNA:GH05582, CG8740 
 Accession No (Link to NCBI) NM_136567.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATGCACAGCTCCCAGCAGCCG 
 Primer Seq. 3'
aatctagaggtaccCCCAACTCGTCCAAGTAGGGC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 ATGCACAGCT CCCAGCAGCC GGCGGAGCGT CTGCCGCTCA CCAAGGGCCG CACCGTGAAC 
0061 GGTCTGGTCA AGCGCTTGTC AATGGAGCGC TTCTCCCCGC AGCCGGCGAT TCAGNCAGCC 
0121 GGCCTTTTCT TACATTCGGC CCAACGAGGG CATCACATAT GCCCAGCTGG ATCTGGGCGA 
0181 GGATCAAGTC CGACGATCGC CAATGGACCG AGATGTCCGC ACACCCCAGA GGGAGTTCGC 
0241 TCCTGCTCGG CCGCCGAGGG CCAGCGATGT GAGGCCCAGT TACTCGCCCA CATCCAATGG 
0301 CGCTCCTTTG GCCAGCAGGC CCAGTCATTC GCCTTCGCCA TGGCAGCAGC TGAGTCCCCG 
0361 CAATCTAAGC GACGAGGACG AGGGCTTGGG TTACGAGCCC AGGAAGGTAT ACTATGAGGA 
0421 GGAGTTCCCC CGAAGGTCGG AACCTCCCAT TGTGCCCGTC ATCAGGAGTG TCAGCCCCTC 
0481 GCCCTACTTG GACGAGTTGG G 
 in silico PCR Fragment
0001 ATGCACAGCT CCCAGCAGCC GGCGGAGCGT CTGCCGCTCA CCAAGGGCCG CACCGTGAAC 
0061 GGTCTGGTCA AGCGCTTGTC AATGGAGCGC TTCTCCCCGC AGCCGGCGA- TCAGCCAGCC 
0121 GGCCTTTTCT TACATTCGGC CCAACGAGGG CATCACATAT GCCCAGCTGG ATCTGGGCGA 
0181 GGATCAAGTC CGACGATCGC CAATGGACCG AGATGTCCGC ACACCCCAGA GGGAGTTCGC 
0241 TCCTGCTCGG CCGCCGAGGG CCAGCGATGT GAGGCCCAGT TACTCGCCCA CATCCAATGG 
0301 CGCTCCTTTG GCCAGCAGGC CCAGTCATTC GCCTTCGCCA TGGCAGCAGC TGAGTCCCCG 
0361 CAATCTAAGC GACGAGGACG AGGGCTTGGG TTACGAGCCC AGGAAGGTAT ACTATGAGGA 
0421 GGAGTTCCCC CGAAGGTCGG AACCTCCCAT TGTGCCCGTC ATCAGGAGTG TCAGCCCCTC 
0481 GCCCTACTTG GACGAGTTGG G 
 Assemble Data

8740R-2.IR_full       1   ATGCACAGCTCCCAGCAGCCGGCGGAGCGTCTGCCGCTCACCAAGGGCCGCACCGTGAAC 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8740R-2.in silico     1   ATGCACAGCTCCCAGCAGCCGGCGGAGCGTCTGCCGCTCACCAAGGGCCGCACCGTGAAC 60


8740R-2.IR_full       61  GGTCTGGTCAAGCGCTTGTCAATGGAGCGCTTCTCCCCGCAGCCGGCGATTCAGNCAGCC 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||
8740R-2.in silico     61  GGTCTGGTCAAGCGCTTGTCAATGGAGCGCTTCTCCCCGCAGCCGGCGA-TCAGCCAGCC 120


8740R-2.IR_full       121 GGCCTTTTCTTACATTCGGCCCAACGAGGGCATCACATATGCCCAGCTGGATCTGGGCGA 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8740R-2.in silico     121 GGCCTTTTCTTACATTCGGCCCAACGAGGGCATCACATATGCCCAGCTGGATCTGGGCGA 180


8740R-2.IR_full       181 GGATCAAGTCCGACGATCGCCAATGGACCGAGATGTCCGCACACCCCAGAGGGAGTTCGC 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8740R-2.in silico     181 GGATCAAGTCCGACGATCGCCAATGGACCGAGATGTCCGCACACCCCAGAGGGAGTTCGC 240


8740R-2.IR_full       241 TCCTGCTCGGCCGCCGAGGGCCAGCGATGTGAGGCCCAGTTACTCGCCCACATCCAATGG 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8740R-2.in silico     241 TCCTGCTCGGCCGCCGAGGGCCAGCGATGTGAGGCCCAGTTACTCGCCCACATCCAATGG 300


8740R-2.IR_full       301 CGCTCCTTTGGCCAGCAGGCCCAGTCATTCGCCTTCGCCATGGCAGCAGCTGAGTCCCCG 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8740R-2.in silico     301 CGCTCCTTTGGCCAGCAGGCCCAGTCATTCGCCTTCGCCATGGCAGCAGCTGAGTCCCCG 360


8740R-2.IR_full       361 CAATCTAAGCGACGAGGACGAGGGCTTGGGTTACGAGCCCAGGAAGGTATACTATGAGGA 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8740R-2.in silico     361 CAATCTAAGCGACGAGGACGAGGGCTTGGGTTACGAGCCCAGGAAGGTATACTATGAGGA 420


8740R-2.IR_full       421 GGAGTTCCCCCGAAGGTCGGAACCTCCCATTGTGCCCGTCATCAGGAGTGTCAGCCCCTC 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8740R-2.in silico     421 GGAGTTCCCCCGAAGGTCGGAACCTCCCATTGTGCCCGTCATCAGGAGTGTCAGCCCCTC 480


8740R-2.IR_full       481 GCCCTACTTGGACGAGTTGGG 501
                          |||||||||||||||||||||
8740R-2.in silico     481 GCCCTACTTGGACGAGTTGGG 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_165627.1  CG8740-RC, transcript variant C (CG8740), mRNA 
100   482  NM_165626.1  CG8740-RB, transcript variant B (CG8740), mRNA 
100   482  NM_136567.2  CG8740-RA, transcript variant A (CG8740), mRNA 
0.2   NM_176244.1  CG9696-RE, transcript variant E (dom), mRNA 
0.2   NM_166446.1  CG9696-RD, transcript variant D (dom), mRNA 
0.2   NM_080094.2  CG9696-RA, transcript variant A (dom), mRNA 
0   NM_079205.3  CG7507-RA, transcript variant A (Dhc64C), mRNA 
0   NM_168103.1  CG7507-RB, transcript variant B (Dhc64C), mRNA 
0   NM_001043133.1  CG32045-RD, transcript variant D (fry), mRNA 
0   NM_168357.2  CG32045-RB, transcript variant B (fry), mRNA 
0   NM_169846.1  CG31043-RB, transcript variant B (gukh), mRNA 
0   NM_169845.1  CG31043-RA, transcript variant A (gukh), mRNA 
0   NM_001032021.1  CG31043-RC, transcript variant C (gukh), mRNA 
0   NM_166554.1  CG3612-RA (blw), mRNA 
0   NM_137273.2  CG8060-RA (CG8060), mRNA 
0   NM_137889.2  CG13533-RA (asrij), mRNA 
0   NM_206469.1  CG11870-RD, transcript variant D (CG11870), mRNA 
0   NM_169337.2  CG11870-RB, transcript variant B (CG11870), mRNA 
0   NM_206470.1  CG11870-RC, transcript variant C (CG11870), mRNA 
0   NM_141734.2  CG11870-RA, transcript variant A (CG11870), mRNA 
0   NM_142840.2  CG4723-RA (CG4723), mRNA 
0   NM_078725.2  CG4276-RD, transcript variant D (aru), mRNA 
0   NM_164393.1  CG4276-RA, transcript variant A (aru), mRNA 
0   NM_164395.1  CG4276-RC, transcript variant C (aru), mRNA 
0   NM_132996.2  CG5675-RA (X11L), mRNA 
0   NM_142361.2  CG5319-RA (CG5319), mRNA 
0   NM_141390.1  CG10296-RA (CG10296), mRNA 
0   NM_168153.1  CG32406-RA (CG32406), mRNA 
0   NM_137456.2  CG5733-RA (CG5733), mRNA 
0   NM_134517.2  CG15618-RA (CG15618), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.