National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 8739R-2 
 Symbol stmA  Full Name stambha A 
 CG No CG8739  Old CG No CG8739 
 Synonyms stmA, cmp44E, rbo, stm-A, CG8739 
 Accession No (Link to NCBI) NM_165625.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees phalate adult lethal 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCCTGCTTCTGCAGGCTTGTCA 
 Primer Seq. 3'
aatctagaggtaccTCAGCAGCGGCTTTAGTACAC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CCTGCTTCTG CAGGCTTGTC ATGCCCAGAC CACACTCAAC TTGTTTGTTG AGTCCTTCCT 
0061 GCGGATGGTG CAAAAGCTTC TGGAGGACTC GAACCCCAAC CTTAAGATAA TGGCCACCAA 
0121 TTCGTTTGTG AAGTTCGCCA ACATCAACGA GGACACACCA TCTTACCATC GACGATACGA 
0181 CTTCTTCATC TCGAAGTTCT CTTCGATGTG CCACAGCGAT GCGGCTAGCA TGCGTTGACA 
0241 GTCTGCGTCT GGCGGGAATC AAGGGATTGC AGGGCGTCAT CCGGAAAACA GTGTCCGACG 
0301 ATCTTGTGGA GAACATCTGG GAGGCGGAGC ACATGGAAAA GATTGTGCCC TCGCTGCTAT 
0361 TCAATATGCA GTCCGGGGAT CTAACGCCCG TAGAGGACGC CACCAATGTG ACGCCACCgG 
0421 CCTTGGCCGA GGAAGTTCTC CGTGAGCTGG TGGGACGCGC ctCCTTCGGA CACATTCGCA 
0481 GTGTACTAAA GCCGCTGCTG A 
 in silico PCR Fragment
0001 CCTGCTTCTG CAGGCTTGTC ATGCCCAGAC CACACTCAAC TTGTTTGTTG AGTCCTTCCT 
0061 GCGGATGGTG CAAAAGCTTC TGGAGGACTC GAACCCCAAC CTTAAGATAA TGGCCACCAA 
0121 TTCGTTTGTG AAGTTCGCCA ACATCAACGA GGACACACCA TCTTACCATC GACGATACGA 
0181 CTTCTTCATC TCGAAGTTCT CTTCGATGTG CCACAGCGAT GCGGCTAGCA TGCG-TGACA 
0241 GTCTGCGTCT GGCGGGAATC AAGGGATTGC AGGGCGTCAT CCGGAAAACA GTGTCCGACG 
0301 ATCTTGTGGA GAACATCTGG GAGGCGGAGC ACATGGAAAA GATTGTGCCC TCGCTGCTAT 
0361 TCAATATGCA GTCCGGGGAT CTAACGCCCG TAGAGGACGC CACCAATGTG ACGCCACCGG 
0421 CCTTGGCCGA GGAAGTTCTC CGTGAGCTGG TGGGACGCGC CTCCTTCGGA CACATTCGCA 
0481 GTGTACTAAA GCCGCTGCTG A 
 Assemble Data

8739R-2.IR_full       1   CCTGCTTCTGCAGGCTTGTCATGCCCAGACCACACTCAACTTGTTTGTTGAGTCCTTCCT 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8739R-2.in silico     1   CCTGCTTCTGCAGGCTTGTCATGCCCAGACCACACTCAACTTGTTTGTTGAGTCCTTCCT 60


8739R-2.IR_full       61  GCGGATGGTGCAAAAGCTTCTGGAGGACTCGAACCCCAACCTTAAGATAATGGCCACCAA 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8739R-2.in silico     61  GCGGATGGTGCAAAAGCTTCTGGAGGACTCGAACCCCAACCTTAAGATAATGGCCACCAA 120


8739R-2.IR_full       121 TTCGTTTGTGAAGTTCGCCAACATCAACGAGGACACACCATCTTACCATCGACGATACGA 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8739R-2.in silico     121 TTCGTTTGTGAAGTTCGCCAACATCAACGAGGACACACCATCTTACCATCGACGATACGA 180


8739R-2.IR_full       181 CTTCTTCATCTCGAAGTTCTCTTCGATGTGCCACAGCGATGCGGCTAGCATGCGTTGACA 240
                          |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||
8739R-2.in silico     181 CTTCTTCATCTCGAAGTTCTCTTCGATGTGCCACAGCGATGCGGCTAGCATGCG-TGACA 240


8739R-2.IR_full       241 GTCTGCGTCTGGCGGGAATCAAGGGATTGCAGGGCGTCATCCGGAAAACAGTGTCCGACG 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8739R-2.in silico     241 GTCTGCGTCTGGCGGGAATCAAGGGATTGCAGGGCGTCATCCGGAAAACAGTGTCCGACG 300


8739R-2.IR_full       301 ATCTTGTGGAGAACATCTGGGAGGCGGAGCACATGGAAAAGATTGTGCCCTCGCTGCTAT 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8739R-2.in silico     301 ATCTTGTGGAGAACATCTGGGAGGCGGAGCACATGGAAAAGATTGTGCCCTCGCTGCTAT 360


8739R-2.IR_full       361 TCAATATGCAGTCCGGGGATCTAACGCCCGTAGAGGACGCCACCAATGTGACGCCACCGG 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8739R-2.in silico     361 TCAATATGCAGTCCGGGGATCTAACGCCCGTAGAGGACGCCACCAATGTGACGCCACCGG 420


8739R-2.IR_full       421 CCTTGGCCGAGGAAGTTCTCCGTGAGCTGGTGGGACGCGCCTCCTTCGGACACATTCGCA 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8739R-2.in silico     421 CCTTGGCCGAGGAAGTTCTCCGTGAGCTGGTGGGACGCGCCTCCTTCGGACACATTCGCA 480


8739R-2.IR_full       481 GTGTACTAAAGCCGCTGCTGA 501
                          |||||||||||||||||||||
8739R-2.in silico     481 GTGTACTAAAGCCGCTGCTGA 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_165624.1  CG8739-RB, transcript variant B (cmp44E), mRNA 
100   482  NM_165625.1  CG8739-RA, transcript variant A (cmp44E), mRNA 
96.68   466  NM_001014513.1  CG8739-RC, transcript variant C (cmp44E), mRNA 
0   NM_176435.1  CG8176-RA, transcript variant A (CG8176), mRNA 
0   NM_176436.1  CG8176-RB, transcript variant B (CG8176), mRNA 
0   NM_134894.2  CG3542-RA, transcript variant A (CG3542), mRNA 
0   NM_164521.1  CG3542-RB, transcript variant B (CG3542), mRNA 
0   NM_135176.2  CG9506-RA (slam), mRNA 
0   NM_141554.2  CG8032-RA (CG8032), mRNA 
0   NM_139493.2  CG2083-RA (CG2083), mRNA 
0   NM_143391.1  CG11828-RA (CG11828), mRNA 
0   NM_164836.1  CG12437-RA, transcript variant A (raw), mRNA 
0   NM_165156.1  CG5813-RB, transcript variant B (chif), mRNA 
0   NM_080050.2  CG12437-RB, transcript variant B (raw), mRNA 
0   NM_078859.2  CG5813-RA, transcript variant A (chif), mRNA 
0   NM_139409.1  CG13934-RA (CG13934), mRNA 
0   NM_169894.2  CG5077-RD, transcript variant D (CG5077), mRNA 
0   NM_169893.2  CG5077-RC, transcript variant C (CG5077), mRNA 
0   NM_169892.2  CG5077-RB, transcript variant B (CG5077), mRNA 
0   NM_142621.3  CG5077-RA, transcript variant A (CG5077), mRNA 
0   NM_164772.1  CG14536-RA, transcript variant A (CG14536), mRNA 
0   NM_169059.1  CG2902-RA (Nmdar1), mRNA 
0   NM_134599.1  CG1722-RA (CG1722), mRNA 
0   NM_137076.1  CG6701-RA (CG6701), mRNA 
0   NM_079350.4  CG3297-RA, transcript variant A (mnd), mRNA 
0   NM_168600.1  CG3297-RB, transcript variant B (mnd), mRNA 
0   NM_168601.1  CG3297-RC, transcript variant C (mnd), mRNA 
0   NM_164644.1  CG31648-RA (CG31648), mRNA 
0   NM_078642.3  CG9916-RA (Cyp1), mRNA 
0   NM_143044.2  CG7016-RA (CG7016), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.